Clone Read LE_HBa0029M12_SP6_92374

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0029M12_SP6_92374
Primer
SP6
ID from Seq. Facility
LE_HBa_029_M12-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
646 trimmed for vector and quality, 966 raw
Genbank Accession
Sequence
>LE_HBa0029M12_SP6_92374 (raw untrimmed)
CCCCGGTCATTCCTATGTATACAATTTGTTCATGGTCTCGTCAAGGAAGGCGATTGTTTCAGGGCATATCAGTTGTTGGAGGAAGGAATTCAATTTGGCT
ACTTGCCGTCAGAATTCACTTACAAATTATTGGTAGAAGGTTTGTGCTATGTAAATGATCTTGTTAAGGCCAATGAAGTCGTCAATATGATGTTATATAA
GAAAGACAATGACAAAACAAGGATTTATAACATATATCTTAGAGCTCTTTGTGTTGTTGATAACCCAACAGAGCTTTTAAATGTCCTTGTGACCATGCTT
CAAACTCAATGTCAACCAGATGTAATCACCCTGAATACTGTTATTAATGGCTTCTGCAAAATGGGAAGAATTGAAGAGGCTCAAAAGGTTTTCAAAGATA
TGATGATGGGGAAGTTTTGTGCCCCAAATGGTGTGACGTTCACAACTGTTATTAGCGGGTTTTTAAAACTCGGGAGGGTTGAAGAAGCTCTTGAGTTATT
GCATAGAGTTATGCCTGAAAAAGGTTTAAAGCCCAATGTTGTAACATATAATGCAGTTATCCAGGGGTTATTTAAGTTACATCGGATAGATGAAGCTATG
GAAGTCTTCCATAGCATGGTAAGTGGTGGCATTGTTGCTGATTGCACGACTTATACTGTTATTATTGATGGGTTGTTTGAATCCAACAAAGTTGATGAAG
CCAAAAGATTCTGGAATGATGTTGTTTGGCCTTCAAAAGTTTCATGACCGTTACATATAAGCCATCCATTCTAAAGGGGCCTTTCTCCCCCTGGAAAACA
CATGATGTTTGTCATTATTAAAACAAATTAAGAGATTAGTGCGTCTCCCCATCTGTCTACAAATACACTATGTTTATAAAGGGAATACTTTACTTGAAGT
TAACACAAACACTACTAATATATCTAGCATCCGGATTTATGGACTATCACTGTATCTTTGATGTCA
>LE_HBa0029M12_SP6_92374 (trimmed for quality and cloning vector)
TCATGGTCTCGTCAAGGAAGGCGATTGTTTCAGGGCATATCAGTTGTTGGAGGAAGGAATTCAATTTGGCTACTTGCCGTCAGAATTCACTTACAAATTA
TTGGTAGAAGGTTTGTGCTATGTAAATGATCTTGTTAAGGCCAATGAAGTCGTCAATATGATGTTATATAAGAAAGACAATGACAAAACAAGGATTTATA
ACATATATCTTAGAGCTCTTTGTGTTGTTGATAACCCAACAGAGCTTTTAAATGTCCTTGTGACCATGCTTCAAACTCAATGTCAACCAGATGTAATCAC
CCTGAATACTGTTATTAATGGCTTCTGCAAAATGGGAAGAATTGAAGAGGCTCAAAAGGTTTTCAAAGATATGATGATGGGGAAGTTTTGTGCCCCAAAT
GGTGTGACGTTCACAACTGTTATTAGCGGGTTTTTAAAACTCGGGAGGGTTGAAGAAGCTCTTGAGTTATTGCATAGAGTTATGCCTGAAAAAGGTTTAA
AGCCCAATGTTGTAACATATAATGCAGTTATCCAGGGGTTATTTAAGTTACATCGGATAGATGAAGCTATGGAAGTCTTCCATAGCATGGTAAGTGGTGG
CATTGTTGCTGATTGCACGACTTATACTGTTATTATTGATGGGTTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.956736
Expected error %
0.0883694
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g18020.1 Score 283 E Value 6e-77 Identity 63.70% Align. Length 644bp (99.69%) Frame 3
68416.m02290 pentatricopeptide (PPR) repeat-containing protein contains Pfam profile PF01535: PPR repeat
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g63070.1 Score 127 E Value 5e-30 Identity 34.00% Align. Length 644bp (99.69%) Frame 3
68414.m07125 pentatricopeptide (PPR) repeat-containing protein contains Pfam profile PF01535: PPR repeat
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB01330.1| Score 283 E Value 2e-75 Identity 21.20% Align. Length 644bp (99.69%) Frame 3
unnamed protein product [Arabidopsis thaliana] ref|NP_188429.1| pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_479488.1| Score 228 E Value 7e-59 Identity 18.20% Align. Length 641bp (99.23%) Frame 3
pentatricopeptide (PPR) repeat-containing protein-like [Oryza sativa (japonica cultivar-group)] dbj|BAC84771.1| pentatricopeptide (PPR) repeat-containing protein-like [Oryza sativa (japonica cultivar-group)] dbj|BAC83534.1| pentatricopeptide (PPR) repeat-containing protein-like [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0029M12
Clone
Clone name
hba-29m12
LE_HBa0029M12
C03HBa0029M12
P029M12
Clone type
BAC
Contamination
none
Estimated length
106,385
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found