Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Cloning Vector – pBeloBAC11

Sequence7,507 bases 
>pBeloBAC11
GCGGCCGCAAGGGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATG
CGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCG
GGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAA
CGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAG
TATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAG
CCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTG
TCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCTTGCGGCCGCCCGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTC
TGCCATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAAGGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCAC
TCATCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTT
GTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGG
GATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGA
AACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATAT
CACCAGCTCACCGTCTTTCATTGCCATACGGAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTAT
TTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTA
CGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGATAACTCAAAAAATAC
GCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTCGCCAAAAGTTGGCCCAGGGCTTCCCGG
TATCAACAGGGACACCAGGATTTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAAGCTCATGGAGCGGCGTAACCGTCGCAC
AGGAAGGACAGAGAAAGCGCGGATCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTTGCCGCCGCTGCTGCTGACGGTGTGA
CGTTCTCTGTTCCGGTCACACCACATACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGCTGAAAGTTCTGCAAAGCCTGATG
GGACATAAGTCCATCAGTTCAACGGAAGTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCAGTTTGCGATGCCGGAGTCTGA
TGCGGTTGCGATGCTGAAACAATTATCCTGAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATATGCTGTTTTTGTCTGTTAAA
CAGAGAAGCTGGCTGTTATCCACTGAGAAGCGAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATTAATCTCAGGAGCCTGTG
TAGCGTTTATAGGAAGTAGTGTTCTGTCATGATGCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAGAAATCTTCGTGCGGT
GTTACGTTGAAGTGGAGCGGATTATGTCAGCAATGGACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTACAGCCAGTAGTGCT
CGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTATATATTCTGCTTACACACGATGCCTGAAAAAAC
TTCCCTTGGGGTTATCCACTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATCTTCTTTTTTAGAGCGCCTTGTAGGCCTTTA
TCCATGCTGGTTCTAGAGAAGGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGACAGTCCTGTCTGTGACAAATTGCCCTTAA
CCCTGTGACAAATTGCCCTCAGAAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTATTTAGTGTGACAATCTAAAAACTTGTC
ACACTTCACATGGATCTGTCATGGCGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATCGTCCAGTCAAACGACCTCACTGAG
GCGGCATATAGTCTCTCCCGGGATCAAAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCACCCTACAGGAACATGACGGTAT
CTGCGAGATCCATGTTGCTAAATATGCTGAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGCATTGAAGAGTTTCGCGGGGA
AGGAAGTGGTTTTTTATCGCCCTGAAGAGGATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGTGCGCACAGTCCATCCAGA
GGGCTTTACAGTGTACATATCAACCCATATCTCATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTAGTGAAACAAAAGAAAT
CACCAATCCGTATGCCATGCGTTTATACGAATCCCTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAATCGACTGGATCATAG
AGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGCCTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGCAGAACTCCAATG
CGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGACGACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGATAGTCTGAGGG
TTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTTCTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTGCATGGATT
TTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATTTGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTGACCTGA
TATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCACAGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTTTTTC
CCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGACAGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTACA
CGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCTTCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT
TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTTAATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTC
ATGGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTATCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAAT
AACCCGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCAGGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGG
ATATGGAAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATTAATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCT
GAAGACGTATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAACCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAA
GGGGCTACGTGTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCACGGATGGGTACCAGATCTTCATATTCATGCAGAAGACA
CTCTCCTGCCTTTCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGCTGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCT
CTGCACCGTATTGAAACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCACACCTGATGCTCCGACTGGCCATTGAAACTGTTGC
TCATGACTATGATGTCATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGTATGTGCTGCTGATGTGCTGATTGTTCCCACGC
CTGCTGAGTTGTTTGACTACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAACGTTGATCTTAAAGGGTTCGAGCCTGATGTA
CGTATTTTGCTTACCAAATACAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGGATGCCTGGGGAAGCATGGTTCTAAAAAA
TGTTGTACGTGAAACGGATGAAGTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGATCAACGCTCTTCAACTGGTGCCTGGA
GAAATGCTCTTTCTATTTGGGAACCTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATTAGATAATGAAGCGTGCGCCTGTTA
TTCCAAAACATACGCTCAATACTCAACCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTCGTTAATTGCGCGCGTAGGAGTA
ATGGCTCGCGGTAATGCCATTACTTTGCCTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGATAGTGTTGAGAAGACCTCTCG
GGTATGGTCAGGTAATGAACGTGACCAGGAGCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGACTGGTCAACAGACACCGG
CGTTCGGTCGAAGAGTATCTGGTGTCATAGAAATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGATTATCGTGTTCTGGTT
GGCGAGCTGGATGATGAGCAGATGGCTGCATTATCCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAGCGTTATGCAAGCCG
ATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCTGGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACACCGCCAAATTGC
CTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAACTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGAGGAATTACTT
AAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTGGGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTTAAAACGTC
ATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGCTCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGGACAGGT
CTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTTAAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGTTTAT
CTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTGGCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGATA
ATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA
CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCAC
TCGTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGG
TCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGG
TCTGGGACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGATTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCG
TAACCTGTAGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGCTGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGT
GGACAAAATACCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCAAGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATG
AGGTTGCCCCGTATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTGATGCAGATCAATTAATACGATACCTGCGTCATAATT
GATTATTTGACGTGGTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCACTTTACGGGTCCTTTCCGGTGATCCGACAGGTTA
CGGGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCTTCTTCGTCATAACTTAATGTTTTTATTTAAAA
TACCCTCTGAAAAGAAAGGAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTCTCTGTTTTTGTCCGTGGAATGAACAATGGA
AGTCCGAGCTCATCGCTAATAACTTCGTATAGCATACATTATACGAAGTTATATTCGAT