SGN Marker HBa44O16SP6

SGN-M10004

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39102)
Chromosome
2
Position
75.10 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35577
Forward primer (5'-3')
CTTGTTGGCAATGCAAGAGA
Digested band sizes (using MspI)
Solanum pennellii LA716: 204+265
Solanum lycopersicum LA925: 469
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGGCCGTGAATCATTGAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 469
Solanum lycopersicum LA925: 469
Approximate temperature
55°C
  
Genomic location of HBa44O16SP6  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10004 marker 10004
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)