SGN Marker U223025

SGN-M10015

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40224)
Chromosome
8
Position
18.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35646
Forward primer (5'-3')
TTCCTCAGCATTCCCAAATC
Digested band sizes (using CfoI)
Solanum pennellii LA716: 1000+1100
Solanum lycopersicum LA925: 2500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGCGACAACACCAATTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2500
Solanum pennellii LA716: 2500
Approximate temperature
55°C
  
Genomic location of U223025  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10015 marker 10015
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)