SGN Marker U223257

SGN-M10016

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40226)
Chromosome
2
Position
75.40 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35647
Forward primer (5'-3')
CGTGAATCTGAAAGCTGCAA
Digested band sizes (using DraI)
Solanum pennellii LA716: 231+372
Solanum lycopersicum LA925: 224+372
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CAACAAGTTTTTGGCCTCGT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 603
Solanum pennellii LA716: 603
Approximate temperature
55°C
  
Genomic location of U223257  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10016 marker 10016
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)