SGN Marker U230479

SGN-M10022

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40236)
Chromosome
5
Position
62.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35650
Forward primer (5'-3')
CCTAATTTACGTGCGGCTTC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 75
Solanum pennellii LA716: 50
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCCTTCTTCCCCATTTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 125
Solanum lycopersicum LA925: 125
Approximate temperature
55°C
  
Genomic location of U230479  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10022 marker 10022
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)