SGN Marker U237440

SGN-M10023

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40244)
Chromosome
2
Position
74.90 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35653
Forward primer (5'-3')
TCCACACCTCCACCAATTTT
Digested band sizes (using RsaI)
Solanum pennellii LA716: 106+209+218
Solanum lycopersicum LA925: 218+315
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACCAAGTTGGACGCACTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 614
Solanum lycopersicum LA925: 614
Approximate temperature
55°C
  
Genomic location of U237440  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10023 marker 10023
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)