SGN Marker U288441

SGN-M10026

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40252)
Chromosome
1
Position
20.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35657
Forward primer (5'-3')
ATGTTGGCAAAAGGTAGAAGAGTTG
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 100+200
Solanum pennellii LA716: 300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CTTTACTCTTTAGGAGCGGAATCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 300
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
Genomic location of U288441  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10026 marker 10026
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)