Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker U295750

SGN-M10027

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40253)
Chromosome
6
Position
12.60 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35658
Forward primer (5'-3')
GGTGGCAAAAGTCTTGAAGC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 200
Solanum pennellii LA716: 250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTCAATCTCGATCCCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
Genomic location of U295750  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10027 marker 10027
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)