SGN Marker SSR336

SGN-M1009

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 50
Repeat motif: GCT   Repeat number: 6
Repeat motif:    Repeat number:
Forward primer: GCCCGGGAAATTACTTCTTC
Reverse primer: CGTCTCTTCCATCCCTCGTA
Predicted size: 205
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39228)
Chromosome
1
Position
34.30 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 32158
Forward primer (5'-3')
GCCCGGGAAATTACTTCTTC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CGTCTCTTCCATCCCTCGTA
Enzymes
  
Accessions and product sizes
Approximate temperature
50°C
  
Genomic location of SSR336  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1009 marker 1009
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)