SGN Marker SSR344

SGN-M1017

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 45
Repeat motif: AT   Repeat number: 12
Repeat motif:    Repeat number:
Forward primer: TGTTGCTCGAACTCTCCAAA
Reverse primer: CATAGGAGAGGTAACCCGCA
Predicted size: 275
Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40798)
Chromosome
8
Position
0.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39232)
Chromosome
8
Position
4.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 98
Forward primer (5'-3')
TGTTGCTCGAACTCTCCAAA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CATAGGAGAGGTAACCCGCA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 275+275
Solanum pennellii LA716: 245+275
Approximate temperature
60°C
  
Genomic location of SSR344  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1017 marker 1017
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)