SGN Marker SSR346

SGN-M1019

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 43
Repeat motif: CT   Repeat number: 2
Repeat motif: CT   Repeat number: 8
Repeat motif:    Repeat number:
Forward primer: AAACGCCATATAACACGTTGC
Reverse primer: TGCTTTCCATAGGATTTCCG
Predicted size: 282
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39234)
Chromosome
1
Position
125.00 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14080
Forward primer (5'-3')
AAACGCCATATAACACGTTGC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCTTTCCATAGGATTTCCG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 282
Solanum pimpinellifolium LA1589: 282+286
Approximate temperature
55°C
  
Genomic location of SSR346  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1019 marker 1019
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)