SGN Marker SSR349

SGN-M1022

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 48 High: 48
Repeat motif: ATAAAA   Repeat number: 2
Repeat motif: TA   Repeat number: 11
Repeat motif:    Repeat number:
Forward primer: GAGTGATCATCCATCCTCTCA
Reverse primer: GGAAGAGACTTTGGACTAAGGGA
Predicted size: 241
Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40799)
Chromosome
2
Position
44.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39235)
Chromosome
2
Position
47.50 cM
Confidence
I
Protocol
SSR
Subscript
A


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14086
Forward primer (5'-3')
GAGTGATCATCCATCCTCTCA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GGAAGAGACTTTGGACTAAGGGA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 241+242
Solanum pimpinellifolium LA1589: 233+241
Approximate temperature
55°C
  
Unigene blast matches for primers 
Genomic location of SSR349  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1022 marker 1022
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)