SGN Marker TG158

SGN-M103

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1880
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ATAAGTAAGAAGTAACCTACTTGTTTTTCTTTTAGAATGAAGTAACCTACATTTTTTTTTTGTAGAATGAAGTAACCTACTTGTTTGTTT
TTTTTACAATGAAGTAACCTACTTATTCAAGTGCAACAATATCCAAATTCAATTTTAGAAGCAAAAGAAATACTCTAGTAGGTTAGAATG
TCAGCCAAATTAAATTTGTACTGCTCCCCTAAGACTCTCCAGATTATTACTACTGTGCCTCAACCACTCAGCCAACCCCTTGGATATGAA
AAACAAGTGTACCTTGATGCATTTTGGAATTGTTATCTCTCTAATAGTCTAATTTCATGATAACTGCTGTGCACATGAAAATATCCTCTC
CTACTTTCTTTGTTCTATCCTCTTTCCTCGGAGAGCAGATAAATACTTGTATGTGCCCATGAAGAAGTATTACCCTAATTAAGCCAATAA
ATCTAAC
Reverse sequence
TATTTGTTTTTATCACGCTGTTGCGTGGTCCGTTTCACAATGTCTTGTTTGATTTTTCAAGGTCGAACTAGTACTTCCAAGAACAGTTCA
TTCTATGTTTTATTGTTTCCATTATTTGTTTTGTTGTATCTTTTTTATAGGGTGGAGGCTTGCTTTATGTAGGAGCCAAAGCCCAACGAA
TCCAATCACCAAATCTATTGAAATGAATACATGTTGCTGAGGCCTAAATTGTTAAAAATAGATACTGTCGTTTGTCTAACACCCTCCCCA
TGTATATATGACCCACTAAAACAGCAATTTTATTACCTTACAAAAAAATTAATTTCTTCTTTTTATTAATTTTCTATTAGTTTTGGTCCA
AACTCAAATATTGGTGGTTGTTGTTAAGCCTCATTTTGAGTTGACAGAAAGGCAGCACTTTCTTTTGATACCCGGCTTTTCCAAGAGCTT
TTATCATCACACGAGTCTTTTAATGTTAGTACTTT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42410)
Chromosome
1
Position
147.30 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39916)
Chromosome
1
Position
158.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8102)
Chromosome
1
Position
157.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8101)
Chromosome
1
Position
126.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG158 was used as an overgo probe on plate 4 [well G1]

Plausible BAC Matches:   P131C09,   P079B04,   P209F06,   P131F15,   P011D23,   P191G19

 Overgo Sequences

A sequence
TATCCTCTCCTACTTTCTTTGTTC
B sequence
CCGAGGAAAGAGGATAGAACAAAG
AB sequence
TATCCTCTCCTACTTTCTTTGTTCTATCCT
Marker sequence
ATAAGTAAGAAGTAACCTACTTGTTTTTCTTTTAGAATGAAGTAACCTAC
ATTTTTTTTTTGTAGAATGAAGTAACCTACTTGTTTGTTTTTTTTACAAT
GAAGTAACCTACTTATTCAAGTGCAACAATATCCAAATTCAATTTTAGAA
GCAAAAGAAATACTCTAGTAGGTTAGAATGTCAGCCAAATTAAATTTGTA
CTGCTNNNNNTTGGATATGAAAAACAAGTGTACCTTGATGCATTTTGGAA
TTGTTATCTCTCTAATAGTCTAATTTCATGATAACTGCTGTGCACATGAA
AATATCCTCTCCTACTTTCTTTGTTCTATCCTCTTTCCTCGGAGAGCAGA
TAAATACTTGTATGTGCCCATGAAGAAGTATTACCCTAATTAAGCCAATA
AATCTAAC
Genomic location of TG158  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D103 marker 103
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)