SGN Marker BAC13024

SGN-M10926

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40725)
Chromosome
8
Position
11.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36560
Forward primer (5'-3')
TGGTACGTCGCACCTTAAAA
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
CAGCGCACTCCAAACAGT
Digested band sizes (using Tsp45I)
Solanum lycopersicum TA209
160
Solanum pennellii TA56
120
Mg+2 concentration
1.5mM
   Enzymes
  
Genomic location of BAC13024  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D10926 marker 10926
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)