Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker CT173

SGN-M115

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
400
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
TTTTTTTTTTTAAAAATTCAAACTCCAATTATTTGCAGTATAAAACTACAGATACAAATCCCAGTACATGGTTTGAGGCACGATAATAAG
GTGCTGATGAAATCCAAGACATGAGTTCACAATACATTACTGACCAATATATTTACAAAGATTAGGGTAATGGCAGTAAAATCGCTGATT
ACAGACAACATTCTTGGGATATATTTCATCTTAAAGATTAGGATTAGTAGTATGTGTGGCAGTCACAGTAGAGACCATGGCATCAACTCC
GCAGATATTGTGACCCCTGCAGATCTTGTAATATCCGTGTTCTCCCCAAGTCTTTCCCCAA
Reverse sequence
TTGGGGAAAGACTTGGGGAGAACACGGATATTACAAGATCTGCAGGGGTCACAATATCTGCGGAGTTGATGCCATGGTCTCTACTGTGAC
TGCCACACATACTACTAATCCTAATCTTTAAGATGAAATATATCCCAAGAATGTTGTCTGTAATCAGCGATTTTACTGCCATTACCCTAA
TCTTTGTAAATATATTGGTCAGTAATGTATTGTGAACTCATGTCTTGGATTTCATCAGCACCTTATTATCGTGCCTCAAACCATGTACTG
GGATTTGTATCTGTAGTTTTATACTGCAAATAATTGGAGTTTGAATTTTTAAAAAAAAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U143664320 (96.7% of RFLP seq)+
SGN-U143664320 (96.7% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53453)
Chromosome
4
Position
95.82 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51868)
Chromosome
4
Position
70.91 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49323)
Chromosome
4
Position
62.61 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47261)
Chromosome
4
Position
116.94 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42309)
Chromosome
4
Position
111.60 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38992)
Chromosome
4
Position
124.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8163)
Chromosome
4
Position
93.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8162)
Chromosome
4
Position
113.20 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT173 was used as an overgo probe on plate 8 [well D3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTATGTGTGGCAGTCACAGTAGAG
B sequence
GAGTTGATGCCATGGTCTCTACTG
AB sequence
GTATGTGTGGCAGTCACAGTAGAGACCATG
Marker sequence
TTTTTTTTTTTAAAAATTCAAACTCCAATTATTTGCAGTATAAAACTACA
GATACAAATCCCAGTACATGGTTTGAGGCACGATAATAAGGTGCTGATGA
AATCCAAGACATGAGTTCACAATACATTACTGACCAATATATTTACAAAG
ATTAGGGTAATGGCAGTAAAATCGCTGATTACAGACAACATTCTTGGGAT
ATATTTCATCTTAAAGATTAGGATTAGTAGTATGTGTGGCAGTCACAGTA
GAGACCATGGCATCAACTCCGCAGATATTGTGACCCCTGCAGATCTTGTA
ATATCCGTGTTCTCCCCAAGTCTTTCCCCAA
Genomic location of CT173  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D115 marker 115
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)