SGN Marker SSR478

SGN-M1151

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 52 High: 48
Repeat motif: GGTG   Repeat number: 2
Repeat motif: CT   Repeat number: 16
Repeat motif:    Repeat number:
Forward primer: GCAGCATATATCACCTTGGCT
Reverse primer: CGTGCTCTCCAATAGTTCACC
Predicted size: 272
Derivations 
This marker was derived from EST read SGN-E14430
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39251)
Chromosome
1
Position
0.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 1
Forward primer (5'-3')
GCAGCATATATCACCTTGGCT
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CGTGCTCTCCAATAGTTCACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450+450
Solanum lycopersicum LA925: 400+450+450
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR478 was used as an overgo probe on plate 1 [well A1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCGCTGACTATGGATCGCTCTCAG
B sequence
CGAGATGAGAGTACAGCTGAGAGC
AB sequence
TCGCTGACTATGGATCGCTCTCAGCTGTAC
Marker sequence
TGCACACACCCCCCATGCGCGCACGTTAGGNCCTACANATTANNGTTANT
GNTCTGNNGGCNGANAGTNGGNGTGNAGCAGCATATATCACCTTGGCTAG
CCCNCNCATCNCNCAGTGTGTGGTGNNTNTATTGTNCNNGAGTNGTGTGC
CCCTCNTGCNGNGNCCCNCGCNTNNCTTATGNAATTGAANANCNTNCNTA
CNGCANGCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTGGTGGGTGAGN
CATANATGTGAATAACCNANCNATGTATATATGTCTCTGCANTTTTCCTA
CTCTGANGCNACACCACATGAATGTAATGGTGAACTATTGGAGAGCACGA
ATGATATTATCCACNAGNAGTGCTATGAGTGTAGTATTGCTTCTTCTCTT
TGTGAGTGTCATAATTCCTTTACGTATATCCAGTATCCAATGTACTGTGA
TATATACTCTTAATATTTTACCTTCTGTATGGACGCTTTTCTANGTTTTC
ATTTATCTCACACAATAGTTATAATAGTATGGTATTGCATGTTGTTTCTC
TGCTATCTCATCGTGTTTATATAATTAATATATATATTACATATGGTATA
GGATCTCCATTAGTATATAGTCATATTGCTCTCTTATTCTTCNCTATTAT
CTACCTGTCGAAGATTATATATCGTGTCTACATAATCTATTTTTATTGTG
CAACTCCTCTTATCATATAGAACCTATCTACTATTTCTTTGAGTGTATAT
TATAATATCAATGATGATACTACNGATATTGCATTTCTCTCTCTACTACT
CACCATCTTTTCTAATAATATCATAGTGATACTGATAATCTTGTATGTTC
TTGGTGATTCTAATCCTACTCTCATATATAGATCATNGAGGTTCCTCTCT
TACACTATCTATTCGCTGACTATGGATCGCTCTCAGCTGTACTCTCATCT
CGTTCTATGTATCGTTACTACTACTACATCTCTACTATCTTCCATCTATC
GCATTATATATACTACAATATATTCATCTATATCTTCANATGTAGTGACA
TCATTCTCTTTCTTACGTNGTTCATTGCACGTTATAATACATTATGTACG
TATTACTCCNACATATATATCTTCTTCTATGACTTCTCTCTCTTGTACTA
NCCTCTAACACACTGTGTAATATTCCTGCATATGTATATATAANTGTTAC
TCTTACTTCTTCTTTGGTAGAATCTCATACTATAAACTCTACTTGTCTCC
ATGTCTCTCATCACTCTTATGTACATATATGTGTACTTCCTACATAGCTC
ATCATCATGTCTGTGTTCTATACCTACCTCTCCANTACTATATAGATGTT
ATTCTCTCCATGTGATGTATTACATATATATATGTCTCTATTCTCTGTTA
NTCTCTACTCAATTCTCTTATACATCCANTCTACAGTGTCTATCTCATGC
TACATATTGTTCTCTACTATTTCTGTCATANGTGAGTCATATTNTCACTA
TCATTCATTCTTACTNCTTACTCTATTACATCTATTACTACTACTCTCCA
TCTCNTATATCTACTGATTNACTCGTGTGTCCACTCCTAATCTATATGCN
CATGATATACATATTATTACGTTACTCAGTGGTATCAATCTTATTATCAT
GTATACTCATTTATGTACTCTATATNTAGTCTGTCTTACATCTCATCNTC
AATTCTCAGTTATTGTGATGTATATTGTACATATCTGCTCTAACACNTAT
ACTCCGTATANTATATATCTCANCACTCTAGTAGTNTATAGTACTATTAT
AATGTATATATATATAGTATTTATCTCTCTCCTCCCTCTCCCACGCTCTC
NCTCTCCNCGCT
Genomic location of SSR478  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1151 marker 1151
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)