SGN Marker TG161

SGN-M116

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1820
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ATTTCTGGTGTTCCCGTGGTGCACGGCAAGTTTAGGGAGATTTCCCGACTCCTGCACTCCAGCACCCGTGTCCAATTGAACTCTGCAACT
GTATCCAATTCTGGATCTTCTGGTACAGCCAGCTCCATGTGCACCACGCTGTTTTCCTTGGCTGTGGCCCTCAAGGATTTGGGTAACATC
AGTTATAACCGAGCAAAGCGCATTGTCGATTCTCGCATTACTGGAGATGATGAATTTCCTGCAATGCTGATAAAAGAATGTCCTCGCCCT
GATCAGCTAAAAGCTCTTTTCGCATCTTTGGTGTCAGCTCACTCGGATGAGGAATATGTTAAGTTCTCACATGATGTCAGCTCTTTACTG
GTGATGGTAGAGAAAATAATTTCCTGGGAAGCCCTGGCTGCTTTCCTTTCCCTTGAAGGAAGGGACTTCATTCCTTCAGGCGATACGAGT
GTAGGCGAAGACAGTGCAAAG
Reverse sequence
AATGCCGCAGTCTTAAGTTAATTAGCCTTCAAACAAATGTTAGCCATTAAGCTGATCAAAAAACTTCGCCACATGATCTCTCTTGGGTCC
AAAGGGATTTATAGTTGTCATGGCCTCATAACTTTCACTCACTTATCCAAAAAAAAAATAAAGGCTTACATCATTAAGATTCCACCTCTG
GATCCTCTCATTAGGGGTCATCCAAATATTGTCATTGCATCATCTAAAAGCTAGTGTACATCCTTCAACATTTTCCATCCAGTTGCTGGA
ATACCTCCACCAAATCCCACATGGACAGTAACTATTCCATAAGTGCAGACATTGAGCAAAAAGCATAATAATAGTCATTGCTAAATTGAA
TATTGAAGTGTTGAAAAAGTAATTAAGAGAAAGTGTATGAGTTAGATTACTTTTGTTTTTGATAAACTTGAGAATTTATTACAGGGATAA
ATATCAGAGTTTTATTCAAAAGTGGTAAATATTAAA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50348)
Chromosome
1
Position
83.26 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48283)
Chromosome
1
Position
117.40 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39918)
Chromosome
1
Position
126.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8167)
Chromosome
1
Position
92.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG161 was used as an overgo probe on plate 14 [well H5]

Plausible BAC Matches:   P008C04,   P001P14,   P175O01,   P054O24,   P034P09,   P260J04,   P210A22,   P277E13,   P304P01,   P289G01,   P139N13,   P295N06,   P043D23

 Overgo Sequences

A sequence
TGGCTGCTTTCCTTTCCCTTGAAG
B sequence
GGAATGAAGTCCCTTCCTTCAAGG
AB sequence
TGGCTGCTTTCCTTTCCCTTGAAGGAAGGG
Marker sequence
ATTTCTGGTGTTCCCGTGGTGCACGGCAAGTTTAGGGAGATTTCCCGACT
CCTGCACTCCAGCACCCGTGTCCAATTGAACTCTGCAACTGTATCCAATT
CTGGATCTTCTGGTACAGCCAGCTCCATGTGCACCACGCTGTTTTCCTTG
GCTGTGGCCCTCAAGGATTTGGGTAACATCAGTTATAACCGAGCAAAGCG
CATTGTCGATTCTCGCATTACTGGAGATGATGAATTTCCTGCAATGCTGA
TAAAAGAATGTCCTCGCCCTGATCAGCTAAAAGCTCTTTTCGCATCTTTG
GTGTCAGCTCACTCGGATGAGGAATATGTTAAGTTCTCACATGATGTCAG
CTCTTTACTGGTGATGGTAGAGAAAATAATTTCCTGGGAAGCCCTGGCTG
CTTTCCTTTCCCTTGAAGGAAGGGACTTCATTCCTTCAGGCGATACGAGT
GTAGGCGAAGACAGTGCAAAG
Genomic location of TG161  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D116 marker 116
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)