SGN Marker SL20134_408i

SGN-M11607

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43573)
Chromosome
1
Position
40.10 cM
Confidence
uncalculated
Protocol
INDEL


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43227)
Chromosome
1
Position
59.80 cM
Confidence
uncalculated
Protocol
INDEL


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44917
Forward primer (5'-3')
AACAGCTAGACTGCTAGGGAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GGTCTGGTGAAAAATCAAAAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Assay data  
5' flanking region
TAAAAAGAACAGCTAGACTGCTAGGGAAGT
  
3' flanking region
AAGAAAAAGAAGAAAGAAGAAAGAAGAAAG
  
   Indel
AAG
Genomic location of SL20134_408i  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D11607 marker 11607
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)