SGN Marker CD19

SGN-M117

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GGGGGGGGGGGGCTAATGGCAATGATGTTGTTGTGACTGAATGGCTCAAAACTCATGCACCTGGAACTCGAACCCTCACACAAGGACTAA
AGGGAGATCCTACTTACCTTGTTGTGGAGAACGATGGAACACTCGCGACCTATGGTATCAATGCTGTGTGCACTCACCTTGGTTGTGTCG
TGCCGTGGAATACTGCTGAAAACAAGTTCATTTGCCCTTGCCATGGATCTCAATACAACAATCAAGGAAAAGTTGTTAGAGGACCTGCTC
CTTTATCCTTGGCATTGGCTCATGCAAACGTTGATGATGGGAAAGTGGTGTTTGTTCCATGGGTTGAAACAGACTTCAAAACTGGTGATG
CTCCATGGTGGGCTTAGAAATCCCATCTAGCTTCTATTATTAGTAGTATATAATATTCTCTTGTACCATTGTTACATAGAAGCTTATTCC
CCTTTTTATTATAAAGGAAAAAAAAAT
Reverse sequence
AGGGGGGGGGGGGGCTAATGGCAATGATGTTGTTGTGACTGAATGGCTCAAAACTCATGCACCTGGAACTCGAACCCTCACACAAGGACT
AAAGGGAGATCCTACTTACCTTGTTGTGGAGAACGATGGAACACTCGCGACCTATGGTATCAATGCTGTGTGCACTCACCTTGGTTGTGT
CGTGCCGTGGAATACTGCTGAGAACAAGTTCATTTGCCCTTGCCATGGATCTCAATACAACAATCAAGGAAAAGTTGTTAGAGGACCTGC
TCCTTTATCCTTGGCATTGGCTCATGCAGACGTTGATGATGGGAAAGTGGTGTTTGTTCCATGGGTTGAAACAGACTTCAGAACTGGTGA
TGCTCCATGGTGGGCTTAGAAATCCCATCTAGCTTCTATTATTAGCAGTATATAATATTCTCTTGTACCATTGTTACATAGAAGCTTATT
CCCCTTTTTATTATAAAGGAAAAAAAAATGT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1607727.6e-34104 (21.8% of RFLP seq)+
SGN-U1607734.9e-3574 (15.5% of RFLP seq)+
SGN-U1607732e-145267 (56.0% of RFLP seq)+
SGN-U143796455 (95.4% of RFLP seq)+
SGN-U1607721.9e-31104 (21.6% of RFLP seq)-
SGN-U1607734.9e-3574 (15.4% of RFLP seq)-
SGN-U1607738e-148267 (55.5% of RFLP seq)-
SGN-U143796455 (94.6% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51696)
Chromosome
12
Position
41.91 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42940)
Chromosome
12
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43940
Forward primer (5'-3')
TGATGTTGTTGTGACTGAATGGC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GGATTTCTAAGCCCACCAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Eggplant-COSII   
Map version
63 (location: 42276)
Chromosome
10
Position
39.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38930)
Chromosome
12
Position
12.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8173)
Chromosome
10
Position
31.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8172)
Chromosome
12
Position
7.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8171)
Chromosome
12
Position
29.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
CD19 was used as an overgo probe on plate 15 [well H12]

Plausible BAC Matches:   P233J24,   P329J04,   P127E21,   P234F06

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AACTCATGCACCTGGAACTCGAAC
B sequence
TAGTCCTTGTGTGAGGGTTCGAGT
AB sequence
AACTCATGCACCTGGAACTCGAACCCTCAC
Marker sequence
GGGGGGGGGGGGCTAATGGCAATGATGTTGTTGTGACTGAATGGCTCAAA
ACTCATGCACCTGGAACTCGAACCCTCACACAAGGACTAAAGGGAGATCC
TACTTACCTTGTTGTGGAGAACGATGGAACACTCGCGACCTATGGTATCA
ATGCTGTGTGCACTCACCTTGGTTGTGTCGTGCCGTGGAATACTGCTGAA
AACAAGTTCATTTGCCCTTGCCATGGATCTCAATACAACAATCAAGGAAA
AGTTGTTAGAGGACCTGCTCCTTTATCCTTGGCATTGGCTCATGCAAACG
TTGATGATGGGAAAGTGGTGTTTGTTCCATGGGTTGAAACAGACTTCAAA
ACTGGTGATGCTCCATGGTGGGCTTAGAAATCCCATCTAGCTTCTATTAT
TAGTAGTATATAATATTCTCTTGTACCATTGTTACATAGAAGCTTATTCC
CCTTTTTATTATAAAGGAAAAAAAAAT
Genomic location of CD19  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D117 marker 117
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)