Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker TG163

SGN-M118

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1880
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG163 image not available
Forward sequence
TCTGGGATCATATATGGGATCTTAGAATGCTGAAGTTTCCAGTCCTTGATCTCCCTGGACATACTCACTGGTAATACTCTGTGGCAATAA
TGAAGCTGCTTGCCATCTCTTTAATTAGTTGAGTTTTTGATATAAGATTATTGTCTGGTCCTTCAATGTGTGTCTCACTATGCTGCCTAC
AACTTAATGACTGCTAACTTTTTTTGTTAGGGTTTAGGGTTAGAAGTTTCTTTCTGGATTACCATTTCCTTATTGAGTAAATGCAGTTGA
TGTTTGTTCGCAGGACATGGACTGTCAAGTGCAATCCCGAACATGAAGACTTAATTCTGGTTCTTTCTCTTCATTTCCTTTATCTGTTTG
TCTACCCTATGTATCTGGAAAACATACTTGTGCACACTCTCACTGAGCC
Reverse sequence
CTTAGAAGCTTCCGCATGAAAATGAACTGCAAACGTCATACTAGATAAAATTAAAGAGACCTCTTGCAAAATTCTACATTCCACCTCAGC
AGCGTTAACTCCATCATGAACACATCAAGAATACAGATTTGGAGGGGGATATACTGGAGTGATACAAACATTAATAAAAGAGATGAGTAG
TGTGGCAAAGGGATAATGAGCTCAAAAGATGGATCACGAGTTCATACTTACTTCGAGTTGTACTGATTTATTTTCTTGGAAGATGAGGCT
TGATTGATTCTACAACCACCTGTTAGGAAAAAAAATGCTAAATTAAAACATGAAAACACGTGGTGCCAATTCTCAACTTAAAATAAGACA
ACTCTATTAGACTATTCATCATGTATTAGAAATAATAGCAAATTGCCAAGAATACATGCACACTCATGGGAACATTTTCTATGTTATCCT
GAAATTGGCTCAGAAGTCCAACACAAGAAAAGACACAGATG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1489275.4e-1947 (11.5% of RFLP seq)+
SGN-U1489273.9e-2972 (17.6% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53190)
Chromosome
4
Position
79.01 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50349)
Chromosome
4
Position
63.61 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48284)
Chromosome
4
Position
126.42 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43838)
Chromosome
4
Position
114.10 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43587)
Chromosome
4
Position
114.80 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43298)
Chromosome
4
Position
107.00 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40838)
Chromosome
4
Position
112.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39919)
Chromosome
4
Position
135.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8175)
Chromosome
4
Position
103.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8176)
Chromosome
4
Position
119.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8181)
Chromosome
4
Position
65.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8182)
Chromosome
4
Position
63.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8180)
Chromosome
4
Position
97.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG163 was used as an overgo probe on plate 7 [well A6]

Plausible BAC Matches:   P008F23,   P303H05

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GATGTTTGTTCGCAGGACATGGAC
B sequence
GGGATTGCACTTGACAGTCCATGT
AB sequence
GATGTTTGTTCGCAGGACATGGACTGTCAA
Marker sequence
TCTGGGATCATATATGGGATCTTAGAATGCTGAAGTTTCCAGTCCTTGAT
CTCCCTGGACATACTCACTGGTAATACTCTGTGGCAATAATGAAGCTGCT
TGCCATCTCTTTAATTAGTTGAGTTTTTGATATAAGATTATTGTCTGGTC
CTTCAATGTGTGTCTCACTATGCTGCCTACAACTTAATGACTGCTAACTT
TTTTTGTTAGGGTTTAGGGTTAGAAGTTTCTTTCTGGATTACCATTTCCT
TATTGAGTAAATGCAGTTGATGTTTGTTCGCAGGACATGGACTGTCAAGT
GCAATCCCGAACATGAAGACTTAATTCTGGTTCTTTCTCTTCATTTCCTT
TATCTGTTTGTCTACCCTATGTATCTGGAAAACATACTTGTGCACACTCT
CACTGAGCC
Genomic location of TG163  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D118 marker 118
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)