SGN Marker SSR555

SGN-M1228

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 40 High: 41
Repeat motif: CTT   Repeat number: 9
Repeat motif:    Repeat number:
Forward primer: TTGATATTAACCATGGCAGCAG
Reverse primer: TTGATGGGATTGCACAGAAA
Predicted size: 217
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 52842)
Chromosome
4
Position
39.56 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39260)
Chromosome
4
Position
61.50 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31791
Forward primer (5'-3')
TTGATATTAACCATGGCAGCAG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTGATGGGATTGCACAGAAA
Enzymes
  
Accessions and product sizes
Approximate temperature
41°C
  
Genomic location of SSR555  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1228 marker 1228
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)