SGN Marker SSR557

SGN-M1230

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 45
Repeat motif: ATCT   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: GCCACAAGAAACATTGCTGA
Reverse primer: TACGCGCACGTGCATAAATA
Predicted size: 239
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39261)
Chromosome
7
Position
45.90 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 93
Forward primer (5'-3')
GCCACAAGAAACATTGCTGA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TACGCGCACGTGCATAAATA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 239+239
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR557 was used as an overgo probe on plate 8 [well H3]

Plausible BAC Matches:   P186H11

 Non-Plausible BAC matches

P142N06,   P162B16,   P161D15

 Overgo Sequences

A sequence
ATGCAAGTGATGGCTCTTCGAGAC
B sequence
TTTCTTGTGGCGGCATGTCTCGAA
AB sequence
ATGCAAGTGATGGCTCTTCGAGACATGCCG
Marker sequence
GCATCAATTAGCAATTAATCCAAAACCATAATGGCTGCCAAAAATTCAGA
GATGAAGTTTGCTATCTTCTTCGTTGTTCTCTTGACGACCACTTTAGTTA
ATATGCAAGTGATGGCTCTTCGAGACATGCCGCCACAAGAAACATTGCTG
AAAATGAAGCTATTTTCCTCAAATGTTTTGGGAACTTGTAACGATTATTG
CAACACAAACGCCGATTGCTTCGGAATTACCCTCTGCCCGTGGTGTAAGC
TGAAGAAGTCCTCCAGTGGTTTCACATACAGTGAATGCTCCCTGTTGCCT
TGAACAATATCTACGATCTATCTATCTATCTATCTATCTATCTCTATGTG
TATTTATGCACGTGCGCGTACTTTTTTTAAAAAAAAAATTTCGTCTTTGT
ACCTTTTCCCATCAACACTACTATGTTTAGTGTTGTCTTTGTATGTCTTT
ACCCTTTGGTGTGAAGAATATGAATAAAGGGATATGTATCTAGATATATT
CTAGGTAATGTCCTATTGTTTAT
Genomic location of SSR557  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1230 marker 1230
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)