SGN Marker SSR572

SGN-M1245

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 45
Repeat motif: TC   Repeat number: 11
Repeat motif:    Repeat number:
Forward primer: AATTCACCTTTCTTCCGTCG
Reverse primer: TGCAAAGAACAAAGACCGTG
Predicted size: 275
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39264)
Chromosome
1
Position
136.50 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31829
Forward primer (5'-3')
AATTCACCTTTCTTCCGTCG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCAAAGAACAAAGACCGTG
Enzymes
  
Accessions and product sizes
Approximate temperature
45°C
  
Overgo hybridization and physical mapping 
SSR572 was used as an overgo probe on plate 10 [well E6]

Plausible BAC Matches:   P037D10

 Overgo Sequences

A sequence
GTTTCTCTTGTGGGTGGCAATCAC
B sequence
AAAACCTAGCGGCGGTGTGATTGC
AB sequence
GTTTCTCTTGTGGGTGGCAATCACACCGCC
Marker sequence
TGTTATTTTTTCCCCTTAATTGTGGATGTTGGTTGAGTTATAGATCATCT
AATTTCATTTCTGGGTGTACCTAGAAACTCAATTTTTCATGGGGTTTTCT
TGACCTTTTTATTGAATGCTTCCAACAGAAAAAATCATGGAGGTTGCTAG
AATTAGACAATTGCTGCTCCTTTGGAGTAGAATCAAATCTACCCGTGTTT
CTCTTGTGGGTGGCAATCACACCGCCGCTAGGTTTTGTACTCGCTAAATT
CACCTTTCTTCCGTCGCTGGATTTTCCCCTTTCTCTCTCTCTCTCTCTCT
CTCTTCTTGTAGCACAAGGTACGATCAGTTTTTACAGACTCTTCCGATAG
GTTTGTTGTAAAAGCATGGATTTTGGTTTTGTGTATTGCCCCAAAAGGGG
GGAAATCAAGGGGAATCATTTTCCCGAGTTGAAAATTGGGTTGCATCAAG
ACGCCGTTTTGATTATTAAGCTACCAGATTCGAGGGCTTTAAGGATTATG
TCACGGTCTTTGTTCTTTGCAATGGTTCTTTTCATATTGCCGTCAATTGG
GTCCATTTTAAGAGGCTCATTCCACGTAATTGATGATTCTTATGTGA
Genomic location of SSR572  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1245 marker 1245
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)