SGN Marker SSR580

SGN-M1253

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 41
Repeat motif: TTC   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: AACTCATCCTTTCTCTTCCCTT
Reverse primer: CCACATGAAAGCATGCAAAG
Predicted size: 253
Derivations 
This marker was derived from EST read SGN-E21844
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49374)
Chromosome
2
Position
40.62 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47309)
Chromosome
2
Position
84.46 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39266)
Chromosome
2
Position
78.00 cM
Confidence
CF(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 32037
Forward primer (5'-3')
AACTCATCCTTTCTCTTCCCTT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CCACATGAAAGCATGCAAAG
Enzymes
  
Accessions and product sizes
Approximate temperature
41°C
  
Genomic location of SSR580  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1253 marker 1253
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)