SGN Marker SSR589

SGN-M1262

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 55
Repeat motif: ACAA   Repeat number: 6
Repeat motif:    Repeat number:
Forward primer: CTACCCTGGTCTTGGTGGAA
Reverse primer: AAAGGATGCTCTAGCTTCTCCA
Predicted size: 148
Derivations 
This marker was derived from EST read SGN-E172309
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39268)
Chromosome
1
Position
39.70 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 32141
Forward primer (5'-3')
CTACCCTGGTCTTGGTGGAA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AAAGGATGCTCTAGCTTCTCCA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 148
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR589 was used as an overgo probe on plate 10 [well G6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCTGAGGGATATCTGATTTGGGAG
B sequence
AATTTGGCTTGTCGGCCTCCCAAA
AB sequence
CCTGAGGGATATCTGATTTGGGAGGCCGAC
Marker sequence
GTACTTCAGAACTGCAAAATTGTACCAGAACAATCACTCTTTGATGATAG
GTTCAAATACGAACACTACTTAACGCGCCCATGGAAGGCATATTCCACCA
ATGTTTTCATGGAAAGTGAGATCGGTGACCTCATCAGGCCTGAGGGATAT
CTGATTTGGGAGGCCGACAAGCCAAATTTTTTCGAACAGACATGTGAAGT
GTATGAATATGCAAACAGAGGACCTGGTGCTAACACTAACGGAAGGAGCA
AACTCTTCAAGAAGTTCAAGGTTCTTAGCCCACAGGAAGCTACTAAATAC
ACCGCTGCCACTTTCCTTCAAGCTAATGAATGGTTGCCTGGAACCAGTGC
ACCTTTCTACCCTGGTCTTGGTGGAAAATAGATCATCACAAACAAACAAA
CAAACAAACAAACATCATTTTCCCTACTTCTCAACACCCCTTTCTCTACC
TACCAATTCAATATTCTTCTTTCATTTTTTGTTGGAGAAGCTAGAGCATC
CTTTTGTTAGCAAAAAAAAAAATGATGCATACTTTTGTTCTTTTTGTGTA
TGTAACCAATTC
Genomic location of SSR589  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1262 marker 1262
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)