SGN Marker SSR595

SGN-M1268

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 45
Repeat motif: TA   Repeat number: 10
Repeat motif:    Repeat number:
Forward primer: ATTGAAGACCGAAACGGTTG
Reverse primer: AAAGCTCCAGCGTCAGAGTG
Predicted size: 271
Derivations 
This marker was derived from EST read SGN-E98985
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39272)
Chromosome
1
Position
147.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14081
Forward primer (5'-3')
ATTGAAGACCGAAACGGTTG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AAAGCTCCAGCGTCAGAGTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 271
Solanum pimpinellifolium LA1589: 271+275
Approximate temperature
55°C
  
Genomic location of SSR595  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1268 marker 1268
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)