SGN Marker CT172

SGN-M127

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
TTTTTTTTTTTTTCTCCCATTCATCATTCTCTCTTTGGCTCATTCTCCCAGAAAAAAACATTCTCTTCATCCGCCATTAACGCTCGCCGC
ATCACAAGCTTCGCTCCATCAACAGCACCATTTTTTTTTTTTGATCTTCCAATAGTCAAAGAGGTTGGAGGATCAGATCTAGGAGTTGAA
ATCATGTCGTTTACAGGGACTCAACAGAAATGTAAGGCTTGTGAAAAAACTGTTTACCCAGTTGAGCTTTTGTCAGCTGATGGGATTAGT
TATCACAAATCTTGTTTCAAGTGTACTCATTGTAAAGGAACTCTCAAGTTGAGCAGTTACTCCTCAATGGAAGGTGTTCTGTATTGCAAG
CCTCATTTTGAGCAGCTCTACAAGGAGTCTGGCAACTTCAATAAGAACTTTCAATCCCCTGTGAAGTCAGCTGAGAAGTTAACTCCAATG
CTGACAAAATCTCCAAGCAAAGCTG
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1522823.5e-0833 (6.9% of RFLP seq)+
SGN-U1441372.3e-12164 (34.5% of RFLP seq)+
SGN-U1462913.4e-42107 (22.5% of RFLP seq)+
SGN-U146291343 (72.2% of RFLP seq)+
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49322)
Chromosome
5
Position
62.11 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47260)
Chromosome
5
Position
107.49 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42954)
Chromosome
5
Position
29.70 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43954
Forward primer (5'-3')
CCCATTCATCATTCTCTCTTTG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GCTTTGCTTGGAGATTTTGTCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Eggplant-COSII   
Map version
63 (location: 42308)
Chromosome
5
Position
21.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38991)
Chromosome
5
Position
95.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8212)
Chromosome
5
Position
22.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8211)
Chromosome
5
Position
61.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8216)
Chromosome
5
Position
85.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT172 was used as an overgo probe on plate 15 [well C5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCTCTTCATCCGCCATTAACGCTC
B sequence
AAGCTTGTGATGCGGCGAGCGTTA
AB sequence
TCTCTTCATCCGCCATTAACGCTCGCCGCA
Marker sequence
TTTTTTTTTTTTTCTCCCATTCATCATTCTCTCTTTGGCTCATTCTCCCA
GAAAAAAACATTCTCTTCATCCGCCATTAACGCTCGCCGCATCACAAGCT
TCGCTCCATCAACAGCACCATTTTTTTTTTTTGATCTTCCAATAGTCAAA
GAGGTTGGAGGATCAGATCTAGGAGTTGAAATCATGTCGTTTACAGGGAC
TCAACAGAAATGTAAGGCTTGTGAAAAAACTGTTTACCCAGTTGAGCTTT
TGTCAGCTGATGGGATTAGTTATCACAAATCTTGTTTCAAGTGTACTCAT
TGTAAAGGAACTCTCAAGTTGAGCAGTTACTCCTCAATGGAAGGTGTTCT
GTATTGCAAGCCTCATTTTGAGCAGCTCTACAAGGAGTCTGGCAACTTCA
ATAAGAACTTTCAATCCCCTGTGAAGTCAGCTGAGAAGTTAACTCCAATG
CTGACAAAATCTCCAAGCAAAGCTG
Genomic location of CT172  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D127 marker 127
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)