SGN Marker SSR599

SGN-M1272

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 41 High: 43
Repeat motif: TCA   Repeat number: 6
Repeat motif: TCATTA   Repeat number: 2
Repeat motif:    Repeat number:
Forward primer: GGATTTCTCATGGAGAATCAGTC
Reverse primer: TCCCTTGATCTTGATGATGTTG
Predicted size: 286
Derivations 
This marker was derived from EST read SGN-E113001
Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40804)
Chromosome
9
Position
109.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39275)
Chromosome
9
Position
103.00 cM
Confidence
F(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14141
Forward primer (5'-3')
GGATTTCTCATGGAGAATCAGTC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCCCTTGATCTTGATGATGTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 286+282
Solanum lycopersicum LA925: 286+285
Approximate temperature
55°C
  
Unigene blast matches for primers 
Genomic location of SSR599  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1272 marker 1272
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)