SGN Marker TM14

SGN-M1284

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40146)
Chromosome
2
Position
12.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40147)
Chromosome
12
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
TM14 was used as an overgo probe on plate 3 [well A11]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CATTGAGACTCTACCCACCGGTAG
B sequence
CCTCTTGTCAATGCGACTACCGGT
AB sequence
CATTGAGACTCTACCCACCGGTAGTCGCAT
Marker sequence
GGNCGACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCG
GCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACGAGG
CTTCTGTCTTATTAACTTGGACACTTCTTCTTCTAGCATTGCATCAAGAG
TGGCAAGATAAAGCCTCGAGAAGAAGTTTTCCGAGTTTGTAAGGGTAACA
ACCTTCCAAGTGCAGAGAATCTGAATGATTTCAAGATTGTGACAATGATA
CTCAATGAGACATTGAGACTCTACCCACCGGTAGTCGCATTGACAAGAGG
AACTTCTAAAGACATCAAGTTGGGAGACCTTGAAATTCCTGCGAATACTC
AATTTTATGTGGCACTAGCTGCTGTGCATCATGACACTGGGATAT
Genomic location of TM14  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1284 marker 1284
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)