SGN Marker TM18

SGN-M1288

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40151)
Chromosome
7
Position
44.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
TM18 was used as an overgo probe on plate 9 [well A5]

Plausible BAC Matches:   P302F20,   P060P15,   P123O23,   P114P05,   P128P03,   P149E21,   P067I14,   P268F19,   P030B22,   P018F09,   P111P06,   P005B02,   P001N12,   P098L04,   P166E06,   P067N12,   P167C01,   P072A08,   P011O19

 Non-Plausible BAC matches

P173L15,   P320C20,   P052A14

 Overgo Sequences

A sequence
CAACACCATCACCAACACCATCAC
B sequence
TGATCACCCTCTATCGGTGATGGT
AB sequence
CAACACCATCACCAACACCATCACCGATAG
Marker sequence
GCTCTACATAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGC
TCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACGAGGATCAA
GCAAGTGGTGTGCATTTTGTTCTTGGTGATTTCAACTCCATTTGTGCAAA
TTGAAGCTAGAAATAGCAAGTTTATGATCATTCCTACATCTCCTTCACCT
GCTCCTACTCCGATTTCTAATGAAATTAGTTTCCCTCCTTTTTCATCGTT
AAGTCCAACACCAGTACCAGCACCAGCACCAGCACCAACACCGGACTTTA
ATGATTTTGGATTTCCTCCTTTGTCGTTTTTAAGTNCAACACCATCACCA
ACACCATCACCGATAGAGGGTGATCAAGATCCTGGTTTGCAACACCGGCG
GGGGCACCGGAGGAAGGTGACATTGAAGCACCAGCACCACTTTTGGGTGA
CACTCCTTATGGACTTTATGGNCTCATTCTNAGGAAGTTCTTCTACTACT
CTACAAATTTTGATGATGTANAAAAGAATTACAAGNGCCCGTTAACACGG
ACGAGTCTACATTACCATACAACACCATACCATGGTTCTTGTATTACACT
NCATAGCCCTCGAGATCACACACATGGTATCCAAATCTCACACACCACAC
AAGATTNTGGGATTCACACT
Genomic location of TM18  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1288 marker 1288
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)