SGN Marker TG83

SGN-M129

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
900
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
TG83 image not available
Forward sequence
GGGGGGGGGGGGGTAAAACTGATTATACTTACAAGCTGGATTAGTAAAAATACCCTGCAAATGGATCAGAAACAGAATTAACGAGAGGGT
AGTACACAAAATGTTAAGCTCAATCCTATTATCAAAACCAACACTAAAGTGATTGCACATGACGAAAGAAGCATGCTAGATGAGTTTGTC
ATACCCAGCACCAAAATGAGCAACCTGGCCTGTCCAGAAAACACAACATCATTCAGCAATTTATCATATACTGATAAAACTACATATGAC
TGACTTATTAAATCTGAAGTAATGCATCTATACTAACCATAGATTGAAATGATCTCTGCTGGAAGAAGAAAGGGTAGTACAATTAGAGAA
ATATTCATAAAAAGCTTGGCAGACCACCATCCTGAGTGCCATAATTCTCTGCGGTCATTTAATTTCGAAGTACCAGCTGTAGATAGGAAC
ATGGCGAAATAGAATAGCTATAATGACCATGTTAAGGATTGACTCAGAAAATCAATAATTTCA
Reverse sequence
GAGATATAGCAAGATCAAGAAAGGATCCTGGTTAGACCAATTTCGACATGGCTCTAATCCTTGGATGGCTAGATATCTTTACGCCATATT
GTTTCTCATTGCTAATTTATTAGCTTGGGCTGTTCGTGATTATGGCCATAGCATTTTGAAAGAAATGAAGAGTAAGATTGCTTCATTCTT
TATTTTGGCCATAGATTTCTATTTCTAGTGCTACATCTGTAGTACACGATTCTAACGGTGTGTATATGTATACCTGTAGGACTTAAAGGA
TGTAATGGTGGTGAAGACTGTATGGGTGCAGAAGGAGTATTGAGAGTAAGCTTGGGGTGTTCTGTATCCTACCTATCTCTAATCCCATTT
GATTCAAATTAGCTAGTTGTAAAATTTACTCAATGATAGTAATAAGTTGAAACTTTTATGGCTTTGTATGATCATGAAGCTCGATGATGA
AATTATTGATTTTCTGAGTCAATCCTTAACAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1521346.6e-1642 (8.2% of RFLP seq)+
SGN-U1521344.1e-51101 (19.7% of RFLP seq)+
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42503)
Chromosome
1
Position
103.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Pepper-COSII   
Map version
58 (location: 41638)
Chromosome
1
Position
198.70 cM
Confidence
F(LOD3)
Protocol
RFLP


Pepper-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40130)
Chromosome
1
Position
100.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 8224)
Chromosome
1
Position
59.97 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Pepper-FAO3   
Map version
31 (location: 8223)
Chromosome
1
Position
46.92 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Eggplant-LXM 2002   
Map version
29 (location: 8220)
Chromosome
1
Position
121.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8219)
Chromosome
1
Position
77.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 35636
Forward primer (5'-3')
TTATGGCACTCAGGATGGTG
Digested band sizes (using HpaII)
Solanum pennellii LA716: 700+800
Solanum lycopersicum LA925: 600+900
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGCATGAAAACCACAAAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Solanum lycopersicum LA925: 1500
Approximate temperature
60°C
  
PCR data   Exp. ID 12
Forward primer (5'-3')
Unknown
Digested band sizes (using HpaII)
Solanum pennellii LA716: 700+800
Solanum lycopersicum LA925: 600+900
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Solanum pennellii LA716: 1500
Approximate temperature
60°C
  
Overgo hybridization and physical mapping 
TG83 was used as an overgo probe on plate 1 [well B12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCCAGCACCAAAATGAGCAACCTG
B sequence
TGTTTTCTGGACAGGCCAGGTTGC
AB sequence
CCCAGCACCAAAATGAGCAACCTGGCCTGT
Marker sequence
GGGGGGGGGGGGGTAAAACTGATTATACTTACAAGCTGGATTAGTAAAAA
TACCCTGCAAATGGATCAGAAACAGAATTAACGAGAGGGTAGTACACAAA
ATGTTAAGCTCAATCCTATTATCAAAACCAACACTAAAGTGATTGCACAT
GACGAAAGAAGCATGCTAGATGAGTTTGTCATACCCAGCACCAAAATGAG
CAACCTGGCCTGTCCAGAAAACACAACATCATTCAGCAATTTATCATATA
CTGATAAAACTACATATGACTGACTTATTAAATCTGAAGTAATGCATCTA
TACTAACCATAGATTGAAATGATCTCTGCTGGAAGAAGAAAGGGTAGTAC
AATTAGAGAAATATTCATAAAAAGCTTGGCAGACCACCATCCTGAGTGCC
ATAATTCTCTGCGGTCATTTAATTTCGAAGTACCAGCTGTAGATAGGAAC
ATGGCGAAATAGAATAGCTATAATGACCATGTTAAGGATTGACTCAGAAA
ATCAATAATTTCA
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG83  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D129 marker 129
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)