SGN Marker TM29

SGN-M1293

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51048)
Chromosome
7
Position
1.88 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48984)
Chromosome
7
Position
3.77 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40162)
Chromosome
7
Position
2.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
TM29 was used as an overgo probe on plate 7 [well D9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGCAATGGAAGCTGTCATGGCTTG
B sequence
TTGTTCTAGCTCCCAGCAAGCCAT
AB sequence
TGCAATGGAAGCTGTCATGGCTTGCTGGGA
Marker sequence
GCTCGAATNACCCTCACTAAGGGAACAAAAGCTGGAGCTCCACCGCGGTG
GCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAAAGACCTCGA
TCAATTTATGACACATTATGTTCTGTTGCTCTCTTCCTTTAAAGAACAAC
TGCAACAACATGTCCGCGTCCATGCAATGGAAGCTGTCATGGCTTGCTGG
GAGCTAGAACAATCTCTACAAAGCTTAACAGGGGTAGCACCAGGTGAAGG
TACAGGAGCAACCATGTCTGATGATGATGATGACCAGGCTGATAGTGACA
CAAACTTTTTGGATGGAGGTTTTGATGGACCAGATAGCATGGGATTTGGT
CCTCTTGTACCTACTGAAAGTGAAAGGTCCCTGATGGAGCGTGTTAGGCA
AGAACTCAAGCATGAACTCAAACAGGGTTATAAGGAAAAAATTGTTGACA
TTAGAGAGGAAATTTTACGCAAAAGAAGAGCAGGAAAACTGCCTGGTGAT
ACTACATCTGTGTTGAAAGCTTGGTGGCAATCACATTCTAAGTGGCCTTA
TCCAACTGAGGAAGACAAAGCACG
Genomic location of TM29  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1293 marker 1293
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)