SGN Marker TM10

SGN-M1296

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40142)
Chromosome
7
Position
33.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
TM10 was used as an overgo probe on plate 9 [well B4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAATTCGGCACGGAAACCTGTTAC
B sequence
TTCGACAGGGAAACCAGTAACAGG
AB sequence
GAATTCGGCACGGAAACCTGTTACTGGTTT
Marker sequence
CGAATNACCCTCACTAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCG
GCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACGGAA
ACCTGTTACTGGTTTCCCTGTCGAAAAGTTGTAAACATCATTTTACATGT
ACATTAACAAAGTCTTCGAAATGTAACTAGTACTAATAAAGCTGCTGCTG
CTGCAACATCGTAATCCGTGCTCATAAGTGGAGTTTCGAGAAGGTGATAT
ATATATACTAGTTTTCGAAACGTGCTCGCACGTTTGTCCCATACAATTAT
TATAAAGTTGAATTATTATATAATATTGAAATTAGAAATATTAGTTTTAC
CTGTTAAAAAAAAAAAAAAAAAA
Genomic location of TM10  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1296 marker 1296
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)