SGN Marker TM43

SGN-M1297

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51051)
Chromosome
6
Position
35.13 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48987)
Chromosome
6
Position
49.68 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40175)
Chromosome
6
Position
40.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
TM43 was used as an overgo probe on plate 4 [well G2]

Plausible BAC Matches:   P215M16

 Overgo Sequences

A sequence
TGTATGCCTAGTGAGGTTCAAGGG
B sequence
GTAACGACATCCCAAGCCCTTGAA
AB sequence
TGTATGCCTAGTGAGGTTCAAGGGCTTGGG
Marker sequence
NNATCCTGGNCGTCNCTNNCAAAAGGGAACAAANGCTGGAGCTCCACCGC
GGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGG
CACGGAAGATTAGGTTTTGGCAATAGAGGAGACGCGGAGCTTAGAGGCAT
CCATGGCTACGGACCACTCTGATGATTTAGACCAACTTCTTGACAGTGCT
TTGGATGATTTTCAGAGCCTCAATCTCACTACTGCTTCTCAAAGAAATGG
GGATGGAGAGGGCAAGAAAGAGAGTTCTTGTATGCCTAGTGAGGTTCAAG
GGCTTGGGATGTCGTTACCCAATTTGAAAGCTAANAATAAAGGGAAGCAA
AAGGCTGCCAAGGAGGTGAAGGACCCGCATGTCTCGGAAGCTCTTGATAA
GCTTANAGAGCANACAAGAGAGGCTGCTAAAGGATTGGAATCAGNGGCAG
GGCCAAGACCCAGTGTGGAGAACTNTGGAAGTGATCCAATGATGGAGGAT
TGNGNCAAACAGTTTGANGAGCTGGCTGGTTCTCNGGNCATGGAGTCTAT
TGNANAGACCATGATGC
Genomic location of TM43  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1297 marker 1297
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)