SGN Marker TM1

SGN-M1300

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40141)
Chromosome
1
Position
119.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
TM1 was used as an overgo probe on plate 8 [well B12]

Plausible BAC Matches:   P317C03,   P072I07,   P045B03,   P022G07,   P030M13,   P320E15,   P110I23,   P186C23,   P024D02,   P256P12,   P270P07

 Overgo Sequences

A sequence
GGAGATGCGTATTCTGATGGTTGG
B sequence
ACCAGCTGCATCAAGACCAACCAT
AB sequence
GGAGATGCGTATTCTGATGGTTGGTCTTGA
Marker sequence
NGGCCGACCCTCACNAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGC
GGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGGTCTTTTTCTAGA
TCTACTGCCCCCTCTCTCTCTCTGTGATTCCTTCTTCATCACCGCATTGA
AGAAAGATGGGTTTATCATTCGGGAAGCTTTTCAGCCGGCTGTTTGCCAA
GAAGGAGATGCGTATTCTGATGGTTGGTCTTGATGCAGCTGGTAAAACCA
CCATATTGTACAAGCTCAAGCTGGGAGAGATTGTTACCACCATTCCTACC
ATTGGATTCAATGTGGAGACTGTTGAATACAAGAACATAAGCTTCACCGT
CTGGGATGTCGGGGGTCAGGACAAGATCAGACCATTGTGGAGGCATTACT
TCCAAAACACACAAGGACTTATCTTTGTGGTTGATAGTAATGATCGTGAT
CGTGTTGTTGAGGCCAGAGACGAGCTGCATCGGATGTTGAATGAGGATGA
ACTGAGAGATGCTGTGCTGCTTGTGTTTGCTAACAAGCAAGATCTTCCAA
ATGCTATGAATGCTGCTGAGATCACTGA
Genomic location of TM1  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1300 marker 1300
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)