SGN Marker TM2

SGN-M1301

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from a(n) EST read (ID unknown)
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40179)
Chromosome
9
Position
50.50 cM
Confidence
I
Protocol
CAPS
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40134)
Chromosome
7
Position
58.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35638
Forward primer (5'-3')
CCATCTTCAAGTTGAGCTTC
Digested band sizes (using EcoRV)
Solanum pennellii LA716: 400+850
Solanum lycopersicum LA925: 1250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GTTAGTGCTGGTCACATCCA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1250
Solanum pennellii LA716: 1250
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TM2 was used as an overgo probe on plate 13 [well A10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TTGACAACGCAAAGGCCAAGGAAG
B sequence
CTTGAATCACCTCCAGCTTCCTTG
AB sequence
TTGACAACGCAAAGGCCAAGGAAGCTGGAG
Marker sequence
ATAGAAAAAAGAAATTTCTCCTTTTTCATTAATGTGCAGCTGCCCCACGT
TGTCACTCCCCTTCTTCTTTATCATTTCCTTCTTGACATTATTAGGAGAC
TTGGCCGTGGACTCCATCTACCACTAAAAAGCTAAAGCCATCAGTATACT
CATTTTTTGGTAGCTACTGAAAAAGAGAGAAAAAAAAATGGCTGAAATTC
TTCTTACATCAGTAATCAATAAATCTGTAGAAATAGCTGGAAATTTACTG
ATTCAAGAAGGAAAGCGTTTATATTGGTTGAAAGAGGATATCGATTGGCT
CCAGAGAGAAATGAGACACATTCGATCTTATGTTGACAACGCAAAGGCCA
AGGAAGCTGGAGGTGATTCAAGGGTCAAAAACTTATTGAAAGATATTCAA
GAATTGGCAGGTGATGTGGAGGATCTCTTAGATGACTTCCTTCCAAAAAT
TCAACAATCCAATAAGTTCAATTATTGCCTTAAGAGGAGTTCTTTTGCGG
ATGAGTTTGCTATGGAGATTGAGAAGATAAAGAGAAGGGTTGTTGACATT
GACCGAATAAGGAAAACTTACAACATCATAGATACAGATAACAATAATGA
TGATTGTGTTCTGCTGGATCGGAGAAGATTATTCCTACATGCTGATGAAA
CAGAGATCATCGGTTTGGATGATGACTTCAATATGCTACAAGCCAAATTA
CTTAATCAAGATTTGCATTATGGAGTTGTTTCCATAGTTGGCATGCCCGG
TCTGGGGAAAACAACTCTTGCCAAGAAACTTTATAGGCTCATTCGTGATC
AATTTGAGTGTTCTGGACTGGTCTACGTTTCACAACAGCCAAGAGCGAGT
GAAATCTTACTTGACATTGCCAAACAAATTGGACTGACGGAACAGAAAAT
GAAGGAAAATTTGGAGGACAACCTGCGATCACTCTTGAAAATAAAAAGGT
ATGTTTTCCTCCTAGATGACATTTGGGATGTGGAAATTTGGGATGATCTG
AAACTTGTCCTTCCTGAATGTGATTCAAAAGTCGGCAGTAGAATTATAAT
CACGTCTCGAAATAGTAATGTAGGCAGATACATAGGAGGGGAATCCTCCC
TCCATGCATTGCAACCCCTAGAATCCGAGAAAAGCTTTGAACTCTTTACC
AAGAAAATCTTTAATTTTGATGATAATAATAGTTGGGCCAATGCTTCACC
TGACTTGGTGAATATTGGTAGAAATATAGTTGGGAGATGTGGAGGTATAC
CGCTAGCCATAGTGGTGACTGCAGGCATGTTAAGGGCAAGAGAAAGAACA
GAACATGCGTGGAACAGAGTACTTGAGAGTATGGGCCATAAAGTTCAAGA
TGGATGTGCTAAGGTATTGGCTCTCAGTTACAATGATTTACCTATTGCCT
CAAGGCCATGTTTCTTGTACTTTGGCCTTTACCCCGAGGACCATGAAATT
CGTGCTTTTGATTTGATAAATATGTGGATTGCTGAGAAGTTTATAGTAGT
AAATAGTGGTAATAGGCGAGAGGCTGAGGATTTGGCGGAGGACGTCCTAA
ATGATTTGGTTTCTAGAAACTTGATTCAACTTGCCAAAAGGACATATAAT
GGAAGAATTTCAAGTTGTCGCATACATGACTTGTTACATAGTTTGTGTGT
GGACTTGGCTAAGGAAAGTAACTTCTTTCACACCGCGCATGATGCATTTG
GTGATCCCGGCAATGTTGCTAGGCTCCGAAGGATTACATTCTACTCTGAC
AATGTCATGATTGAGTTCTTCCGTTCAAATCCTAAGCTTGAGAAGCTTCG
TGTACTTTTCTGTTTCGCAAAAGACCCTTCCATATTTTCTCATATGGCTT
ATTTTGACTTCAAATTGTTGCACACATTGGTTGTAGTCATGTCTCAAAGT
TTTCAAGCATATGTCACTATCCCAAGCAAATTTGGGAACATGACTTGCTT
ACGCTATCTGAGATTGGAGGGGAATATTTGTGGAAAACTGCCAAATAGTA
TTGTCAAGCTCACACGTCTAGAGACCATAGACATTGATCGACGTAGCCTC
ATTCAACCTCCTTCTGGTGTTTGGGAGTCTAAACATTTGAGACATCTTTG
TTATAGAGATTATGGACAAGCATGTAACAGTTGCTTTTCTATAAGCTCAT
TTTACCCAAATATTTACTCATTGCATCCTAACAATCTACAAACCTTGATG
TGGATACCTGATAAATTTTTTGAACCGAGGTTGTTGCACCGATTGATCAA
TTTAAGAAAACTGGGTATACTGGGAGTGTCCAATTCTACCGTTAAGATGT
TATCAATATTTAGCCCTGTGCTCAAGGCGCTGGAGGTTCTGAAGCTCAGT
TTTTCCAGTGACCCGAGTGAACAAATAAAGTTGTCATCGTATCCACATAT
TGCTAAGTTGCATTTGAATGTTAACAGAACAATGGCCTTGAACTCTCAAT
CATTTCCTCCAAATCTCATCAAGCTTACTCTAGCCAACTTTACGGTAGAC
CGTTATATACTGGCAGTACTTAAGACATTTCCCAAATTAAGAAAACTTAA
AATGTTCATCTGCAAGTATAATGAAGAAAAGATGGATCTCTCGGGCGAGG
CAAATGGTTATAGCTTTCCGCAACTTGAAGTTTTGCATATTCATAGCCCG
AATGGGTTGTCTGAAGTAACGTGCACGGATGATGTCAGTATGCCCAAATT
GAAAAAGCTGTTACTTACAGGATTCCATTGCCGAATCAGTTTATCGGAAC
GGCTTAAAAAGCTGAGTAAATGAACATCTCAACAGGTCAGTTTGCTAGTA
TAACTATTTACGTACAGGG
Genomic location of TM2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1301 marker 1301
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)