SGN Marker P1

SGN-M1313

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C128684
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39127)
Chromosome
6
Position
38.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P1 was used as an overgo probe on plate 4 [well E7]

Plausible BAC Matches:   P305A04,   P157F23

 Overgo Sequences

A sequence
AAAAGCTTCTGGGAGGAGACTATG
B sequence
CTCATGCTTAGCATCCCATAGTCT
AB sequence
AAAAGCTTCTGGGAGGAGACTATGGGATGC
Marker sequence
GAAATAGAGATAAAGAGAATAGAAAACACAAACAACAGGCAAGTAACTTA
TTCAAAAAGAAGAAATGGTATAATAAAGAAAGCTAAAGAAATTACTGTTC
TTTGTGAAGCTAAGGTTTCACTTATAATCTTTGCTAGTTCTGGAAAGATG
CATGAATATTGTAGCCCTTCTACTACGATAAGTGATATGTTGGATGGTTA
TCAAAAAGCTTCTGGGAGGAGACTATGGGATGCTAAGCATGAGAATTTGA
GTAATGAAATTGATAGAATCAAGAAAGAGAATGACAGTATGCAGGTTAAG
CTCAGGCACCTCAAAGGAGAAGATATCAATCAACTTACCCATAAAGAGCT
TATAATTATGGAAGAAGCCTTACAAAATGGACTTTCTAGTATCAGTGCCA
AGCAGTCTGAAATCTTGAGGATGGTCAGGAAAAATGATCAAATTCTGGAG
GAGGAAAATAAGCAACTTCAATATGCTTTGCACCAAAAGGAGATGGGAGC
CATTGGTGGAAGTGGAAATATGAGAGGAATTCATGAAGAAGTGTATCATC
A
Genomic location of P1  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1313 marker 1313
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)