SGN Marker P26

SGN-M1316

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C20319
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39129)
Chromosome
3
Position
104.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P26 was used as an overgo probe on plate 6 [well A12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCTCATGAGATCTCTGTGCTTTGC
B sequence
GTCCAACTTCAGCATCGCAAAGCA
AB sequence
GCTCATGAGATCTCTGTGCTTTGCGATGCT
Marker sequence
GCACCAGATTAAAACCTCTTTCTCCTACCTGGGGAGATCCTTCCACTTCC
CAATAACGATACAGTTTTTTAATTTATCATTTGCCAAAAACAAAGAATTA
CTAAACATAAATATCCATTTCCATTACACAATATACATATATATACACAC
ACAAAGAAGAAAGAAGAAAGAAGAAATTAATATGGGTAGAGGAAGAGTAC
AATTGAAGAGAATTGAGAACAAAATTAATCGTCAAGTTACTTTTTCAAAG
AGGCGATCTGGTTTGCTTAAAAAAGCTCATGAGATCTCTGTGCTTTGCGA
TGCTGAAGTTGGACTCATTGTTTTCTCAACTAAAGGAAAACTCTTTGAGT
ATTCTACTGACTCTTGCATGGAAAGGATTCTTGAAAGGTATGAAAGGTAC
TCATATGCTGAAAGGCAGCTTAATGCTACTGATATTATAACCCCGGGTAG
CTGGACTTTGGAACATGCTAAGCTTAAGGCCAGACTTGAGGTTTTGCAAA
GAAACCAAAAGCATTATGCAGGAGAAGAGTTGGACACATTGAGTATGAAA
GAGCTTCAGAATCTGGAACACCAGCTCGATTCTGCTCTTAAGCACATTCG
ATCTAGAAAGAACCAATTGATGCATGA
Genomic location of P26  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1316 marker 1316
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)