SGN Marker P48

SGN-M1324

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C91543
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39137)
Chromosome
1
Position
68.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P48 was used as an overgo probe on plate 8 [well G11]

Plausible BAC Matches:   P186L05,   P023D04

 Overgo Sequences

A sequence
AAGCAAGAGACAGCAAGTTTGATG
B sequence
GGAGTTCTATCTTCTTCATCAAAC
AB sequence
AAGCAAGAGACAGCAAGTTTGATGAAGAAG
Marker sequence
ATCTGTGGATATTCATCATACTAAGCAAGAGACAGCAAGTTTGATGAAGA
AGATAGAACTCCTTGAATCATCTAAAAGGAAACTCTTGGGAGAAGGTTTA
GGATCATGC
Genomic location of P48  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1324 marker 1324
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)