SGN Marker P63

SGN-M1333

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C124056
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39145)
Chromosome
1
Position
89.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P63 was used as an overgo probe on plate 9 [well F2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGGCTACTACTGCAAGGGCTGATT
B sequence
ATACCATAAGGTGGTGAATCAGCC
AB sequence
TGGCTACTACTGCAAGGGCTGATTCACCAC
Marker sequence
GTAACAACACACTTTTTTTTATTTTTTTTGCCAAAATGGCCACACCTACT
ATTATTTTGAGCTTCTTGTTGATTTTTGGAGTGGCTATTTGTCAAAGTGA
AGCTAGGGCATTTTTTGTGTTTGGTGATTCACTTGTTGATAGTGGAAATA
ATAATTATTTGGCTACTACTGCAAGGGCTGATTCACCACCTTATGGTATT
GATTATCCAACACGTAGAGCAACTGGTCGTTTCTCTAATGGCTACAACAT
TCCTGACATTATCAGTCAACAAATTGGTTCATCAGAGTCACCACTACCTT
ACTTAGATCCAGCTCTTACTGGACAAAGACTTCTTGTTGGTGCTAACTTT
GCATCTGCTGGAATTGGAATACTAAATGACACTGGAATCCAATTTATTAA
TATTATTCGAATGCCACAACAATTGGCTTATTTTAGACAATATCAAAGTA
GAGTAAGTGGCCTTATTGGTGAAGCAAATACTCAAAGACTTGTAAATCAA
GCTCTTGTTCTTATGACTCTTGGAGGCAATGATTTTG
Genomic location of P63  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1333 marker 1333
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)