SGN Marker P64

SGN-M1334

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C23160
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49357)
Chromosome
12
Position
61.78 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47292)
Chromosome
12
Position
74.46 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39146)
Chromosome
12
Position
76.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
P64 was used as an overgo probe on plate 4 [well B12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGAAATCCAGGTCGCAGAGGTGTC
B sequence
CATTGTTGTGAACCCCGACACCTC
AB sequence
AGAAATCCAGGTCGCAGAGGTGTCGGGGTT
Marker sequence
GCACCAGGATCAATGCAGAAATCCAGGTCGCAGAGGTGTCGGGGTTCACA
ACAATGGGAGAACTGCTACAAACAACAGAAAGGCAACTCGAGGAAACAAA
TGCTGATGGTCTCACTTTGACTGACCTTATCCATTTGGAAAACGAACTTC
AAACTGCTCTAATACATCTCAGAGCTAGAAAGACACATTTGATGCTTGAA
TCTGCTAAGGTTCTTCATGAGAAGGAAAAACTGCTGCTAGAGGAAAAGAA
ACATCTGGAGGACAATATAGCTAGTATCAAGAAAAACACAAAAGTGAATG
AAATGTCTGACCTTCCAGCACCCCACATGATTTGTGGACAACAAAAAGTT
ACCCTGAATTTCTTCTAGTGATTATCGTCGTATTCGTCGAAAAGCCTTGC
TTCTGCACCAGAGGAACCTGCAAAATTAGTTTCAATAAAACTAATAATTA
TTCATCCTTGTTCTTGTTTCTAATGGATGATGATTAAAGTTAACTTCTCT
ACTTTGACATATTTACTAGAGGGTGACTTATATGCCTATTTTTCCCTC
Genomic location of P64  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1334 marker 1334
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)