SGN Marker TG318

SGN-M134

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1610
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG318 image not available
Forward sequence
TTTCTTATTTCCTATTTTACAAGCTATGTATTAATTTGCTGATTTACCAAAGGGTAGAATGAAGGATGATTTCCCTCTCAAAGGATGTGC
CATAAGAATAATTTGTTATTTCATTTCCAATTTCTATTGTGTGCTTCATTTCCATGGCAAAAACAAGTAGTCATGCCATTCAAGTGATTT
TGTAGGCTTGAGTGAAGGGTTTAGGTCTCCAGTGTCAATCTCTATTTGAAATAGATTTTTTTCCGGTTCTCTTTGTTTGCTATAGTGCCA
GGGTTTTTGAGTTTCCAGGGTAATCAATTATCTACCTCAAAATCAGCAGGAAATGCTGACTAACAGTGCTGGACTCAAAGTTCATTCATA
TTCCAAATAGTGTGCATCATTTCTTTTCTATTTTTGCTTCAAGTGCTATCATTGACAGACGAGCTTACTTCAGCCTTTTGGTTCTAGGTT
TGTGATTTAAAGACAG
Reverse sequence
AATTCAGTAACAGTTGAGGTTAAAACAAGCAAGCCATAGAAATTGCCGTAAAGAACTTTATCATATTTCAACAGTCTCATCGCTCATTAA
ATGTCAGAATATGAAAGAAAAAGATAGTCACATAAAGACTAACTATTTGCATGCATACTTACAGTAGATGAAACTCTGAGTACATATTTT
TTAATTAAACTGGACTGTTATTTTGTCAGTATTATTTGTTAAATAAAAAAAGTAAAAGAAACAGACAAATACTCAAGTAGTAAAGTGACA
GAAATTGTAATTCTTTATACAGCACCACTCTGGGAAGAGAGTGCATTTGTTCGTGCCTGTATACATGTGCATGAGACAGAAGGTACCTGT
GTGCGAAGGTCATCTGGACCAAGCTTCTTTTTGAGTATCTGCAAGGTTGTTTGCTCATGTTGAACACTCAAAGCATAAGCTTCCATCACA
GAGAGAGCAATTGCTATAGCATGGTAACTCGCA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53885)
Chromosome
5
Position
57.20 cM
Confidence
uncalculated
Protocol
RFLP


Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53269)
Chromosome
5
Position
22.25 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50369)
Chromosome
5
Position
59.92 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48303)
Chromosome
5
Position
85.25 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39994)
Chromosome
5
Position
72.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8245)
Chromosome
5
Position
46.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8249)
Chromosome
5
Position
23.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG318 was used as an overgo probe on plate 15 [well D6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGGTAGAATGAAGGATGATTTCCC
B sequence
GGCACATCCTTTGAGAGGGAAATC
AB sequence
GGGTAGAATGAAGGATGATTTCCCTCTCAA
Marker sequence
TTTCTTATTTCCTATTTTACAAGCTATGTATTAATTTGCTGATTTACCAA
AGGGTAGAATGAAGGATGATTTCCCTCTCAAAGGATGTGCCATAAGAATA
ATTTGTTATTTCATTTCCAATTTCTATTGTGTGCTTCATTTCCATGGCAA
AAACAAGTAGTCATGCCATTCAAGTGATTTTGTAGGCTTGAGTGAAGGGT
TTAGGTCTCCAGTGTCAATCTCTATTTGAAATAGATTTTTTTCCGGTTCT
CTTTGTTTGCTATAGTGCCAGGGTTTTTGAGTTTCCAGGGTAATCAATTA
TCTACCTCAAAATCAGCAGGAAATGCTGACTAACAGTGCTGGACTCAAAG
TTCATTCATATTCCAAATAGTGTGCATCATTTCTTTTCTATTTTTGCTTC
AAGTGCTATCATTGACAGACGAGCTTACTTCAGCCTTTTGGTTCTAGGTT
TGTGATTTAAAGACAG
Genomic location of TG318  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D134 marker 134
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)