SGN Marker T0028

SGN-M1347
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TOVAP16TH
Arabidopsis best BAC match: AC006420.3
Arabidopsis position: 2.0360000
Arabidopsis identities: 0.907
Best GenBank protein hit: CAB60355.1
Evalue: 3.1e-47
Identities: 0.658
Description: " EST yk157c8.3 comes from this gene~cDNA EST [Caenorhabditis elegans]/ e-37, unknown protein [Arabidopsis thaliana]"
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 43017)
Chromosome
12
Position
18.40 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 44017
Forward primer (5'-3')
AAAACTCCGGCAGAACTCC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GTTTCTTCTTCTTCCTCATCCCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40808)
Chromosome
12
Position
27.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39315)
Chromosome
12
Position
33.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0028 was used as an overgo probe on plate 4 [well A7]

Plausible BAC Matches:   P297J24,   P185L11,   P163O04,   P041B09,   P119N01,   P237F11,   P170D07,   P121O19,   P211A04,   P109N05,   P172G20,   P236E19,   P310J15,   P093B17

 Overgo Sequences

A sequence
AGAGAAAAACTCCGGCAGAACTCC
B sequence
CGCTTGTTTTCACGCAGGAGTTCT
AB sequence
AGAGAAAAACTCCGGCAGAACTCCTGCGTG
Marker sequence
CAGTAGGAGGAGGAAAATTCAATCGCCGATCGATTAATTACGATGAATTT
TCTATTCGGCAAGAGAAAAACTCCGGCAGAACTCCTGCGTGAAAACAAGC
GTATGCTTGATAAATCTATCCGAGAAATAGAAAGGGAGAGACAGGGCTTA
CAAACACAAGAGAAGAAACTAATTGCAGAGATAAAGAAAAGTGCAAAGCA
AGGACAGATGGGAGCTGTGAAGGTGATGGCGAAAGATCTTATTAGAACAA
GGCATCAGATTGAAAAAATTTTACAAGCTTAAGTCCCAACTTCAAGGTGT
CTCCCTCAGAATTCAGACTTTGAAATCAACACAAGCAATGGGTGAAGCAA
TGAAAGGCGTTACAAAGGCAATGGGACAGATGAACAGGCAGATGAATTTG
CCGGCATTGCAGAGAATAATGCAAGAATTTGAGATGCAAAATGAAAAGAT
GGAAATGGTGAGTGAGGTGATGGGAGATGCCATTGATGATGCTTTGGAAG
GGGATGAGGAAGAAGAAGAAACTGAAGAGTGGTGAGCCAGGTCCTTGATG
AGATNGGNATTAATATCAACAATGAG
Genomic location of T0028  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1347 marker 1347
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)