SGN Marker T0040

SGN-M1351
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.01
Tomato EST read: TOVAY55TH
Arabidopsis best BAC match: AC000103.2
Arabidopsis position: 1.0560000
Arabidopsis identities: 0.892
Best GenBank protein hit: AAD11431.1
Evalue: 3e-103
Identities: 0.933
Description: T-complex protein 1 epsilon subunit [Mesembryanthemum crystallinum]
Comment: T-complex protein (TCP) found in mammalian cells and yeast has been proposed as cytosolic folding machinery.
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49509)
Chromosome
5
Position
7.50 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47443)
Chromosome
5
Position
77.97 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40809)
Chromosome
5
Position
56.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39316)
Chromosome
5
Position
66.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0040 was used as an overgo probe on plate 1 [well F12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAGCGGCTGCTGATAAACATCCAG
B sequence
GCGTACTGTTCAACTCCTGGATGT
AB sequence
AAGCGGCTGCTGATAAACATCCAGGAGTTG
Marker sequence
GCCACGAGGCCTGCTGTTAGATGGGTAGGTGGTGTGGAATTGGAGCTGAT
AGCAATTGCCACAGGTGGGAGAATAGTACCAAGGTTTCAAGAGTTGACAC
CCGAAAAACTTGGCAAGGCTGGTATTGTTCGGGAGAAATCTTTCGGTACA
ACAAAGGATAGAATGATCTACATTGAGCATTGTGCAAATTCAAGAGCAGT
AACTATATTTATCCGTGGTGGAAACAAGATGATGATAGAGGAGACAAAAC
GTAGTATCCATGATGCTTTATGTGTTGCTAGAAATCTTATTCGCAACAAT
TCAATTGTATATGGTGGTGGGTCAGCAGAGATTTCTTGCTCAATTGCTGT
TGAAGCGGCTGCTGATAAACATCCAGGAGTTGAACAGTACGCAATCAGGG
CATTTGCAGATGCTTTGGATGCTGTCCCAATGGCACTTGCTGAGAACAGT
GGTCTCCAGCCTATTGAAACTCTATCTGCTGTTAAGTCTCAACAAATTAA
GGAGAATAATCCATGCTGTGGAATAGATTGTAATGATGTTGGCACANATG
ACATGCGTGAACAAAATGTCTTTGAGACTCTTATTGGTAAGCAACAAC
Genomic location of T0040  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1351 marker 1351
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)