Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T0067

SGN-M1354
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 8.07
Tomato EST read: TOVCP78TH
Arabidopsis best BAC match: AC003114.1
Arabidopsis position: 1.0240000
Arabidopsis identities: 0.930
Best GenBank protein hit: AAF17254.1
Evalue: 2.4e-64
Identities: 0.958
Description: small GTP-binding protein Sar1BNt [Nicotiana tabacum]
Comment: Rab and Sar1/Arf families regulate vesicle trafficking
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49534)
Chromosome
1
Position
71.12 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47468)
Chromosome
1
Position
49.24 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40810)
Chromosome
1
Position
57.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39844)
Chromosome
1
Position
46.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0067 was used as an overgo probe on plate 10 [well D2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGAAGCTAAGATCCTCTTTCTCGG
B sequence
TCCGGCATTATCAAGGCCGAGAAA
AB sequence
GGAAGCTAAGATCCTCTTTCTCGGCCTTGA
Marker sequence
GCACCAGATAAAACTGAGATCGGGATCCCCATACCTATCGGCAAACAAAA
GAAGGATGTTTCTCTTCGATTGGTTCTATGGCGTTTTGGCTTCTCTAGGG
TTATGGCAGAAGGAAGCTAAGATCCTCTTTCTCGGCCTTGATAATGCCGG
AAAGACTACTCTTCTTCACATGCTTAAAGACGAGAGATTAGTTCAGCATC
AGCCGACTCAGTATCCGACATCGGAAGAGCTTAGTATTGGAAAAATCAAA
TTCAAAGCGTTTGATTTAGGAGGTCATCAGATCGCTCGCCGTGTTTGGAA
GGATTACTATGCTAAGGTTGATGCTGTTGTATACCTGGTAGATGCTTATG
ACAAAGAGCGCTTCGCTGAGTCAAAGAAAGAATTAGACGCACTGCTATCT
GATGAGTCCCTAGCGACTGTTCCCTTCCTCATTTTGGGAAACAAGATAGA
CATACCGTATGCTGCCTCAGAAGATGAGTNGCGTTATCACC
Genomic location of T0067  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1354 marker 1354
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)