SGN Marker TG246

SGN-M136

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2320
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG246 image not available
Forward sequence
ATCCTCCTTCATTCAGTTTAGATATTACCCAGATAATGTCATCCGACACTAATTGTGTTTATGAACATGAAGACATAGGTTCGACTGAGA
ATAGATCGAAAAAATTGCATGATCCCCTAGTTATGGTCGATGATGAGAAGGTGAAGAAGGATGCGCTTTCTTCTTCAAAAGCAAAGATTG
AAAAACCCCTAAAAAGGGGGTAGAAAAAAGTATAACCCCAATTTTCCGTTCGAATCTAATTGAGGCAATGAGTTCCTATCTGTTGTTGTT
TTTTTTTGTTGCTCAATCTTTGAATCAATTGTTAATCTTTAATCAAGTGTTAATTTGAATCTTTTTTCTATGTAGTTAAAAATTGTTAAA
ATTAACAATTTCATCTTGTATCCAATTATTTGTGTACAAATTTACTTCCCTTATTTCATTTTAAATTTTCATGCTCATTAAAAAGTGTAG
TTTAATAATTTATCT
Reverse sequence
CAAGTTCAATTTCAATTTTCTATTAATTCAATCAATCGATATACATGTGAACTGGGAAATTACTTGAAAATTGGTGTTTAGAGATAATAG
ATGCAATACCACTTTTTCCTCATCCGAAAAGCAACAAGTGGCCTTATAGTTTGTCTACATTCAAGTATGCTGCATCCACTATAATTCATT
TATCAATTCTTGAGTCATATTCTATGTGAATTATCGGGAGACAGTTTGAACTTTATTGTTTAATATAAAATTTATTTAAGTTATCTACAT
TCAAGTATGTAAAGGAATCGTTAATTGCAATGAGATTGACAATTTAAAATATAGTTATAAAATAGTTATATGAAGTAAATATGAATAAAA
TATTGTGAGGAATTGTTACATTATGAAATACACAATTCCAAACAATTAATATATATAATTTATTATTATTTTTTTGGAGTTATTTGTGTT
ACTACATAATAATTTATTTGA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1587069.6e-1873 (15.7% of RFLP seq)+
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50359)
Chromosome
3
Position
57.04 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48293)
Chromosome
3
Position
75.58 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43849)
Chromosome
3
Position
80.90 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43310)
Chromosome
3
Position
68.80 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40848)
Chromosome
3
Position
86.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39959)
Chromosome
3
Position
95.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8255)
Chromosome
3
Position
68.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8259)
Chromosome
3
Position
83.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG246 was used as an overgo probe on plate 1 [well B2]

Plausible BAC Matches:   P004C15,   P324D12,   P086L23,   P245N12,   P285J10,   P305M22,   P246K03,   P228K07,   P303N01,   P246N21,   P279N02,   P031P02,   P327B19,   P050B06,   P279O09,   P147P17,   P124A02,   P217L14,   P114A07,   P086O24

 Non-Plausible BAC matches

P070F16,   P003A09,   P021A02,   P271N16,   P054J03,   P010A10,   P238C06,   P158P24,   P198F11,   P203C20,   P256P24,   P189I08

 Overgo Sequences

A sequence
GCATGATCCCCTAGTTATGGTCGA
B sequence
CTTCACCTTCTCATCATCGACCAT
AB sequence
GCATGATCCCCTAGTTATGGTCGATGATGA
Marker sequence
ATCCTCCTTCATTCAGTTTAGATATTACCCAGATAATGTCATCCGACACT
AATTGTGTTTATGAACATGAAGACATAGGTTCGACTGAGAATAGATCGAA
AAAATTGCATGATCCCCTAGTTATGGTCGATGATGAGAAGGTGAAGAAGG
ATGCGCTTTCTTCTTCAAAAGCAAAGATTGAAAAACCCCTAAAAAGGGGG
TAGAAAAAAGTATAACCCCAATTTTCCGTTCGAATCTAATTGAGGCAATG
AGTTCCTATCTGTTGTTGTTTTTTTTTGTTGCTCAATCTTTGAATCAATT
GTTAATCTTTAATCAAGTGTTAATTTGAATCTTTTTTCTATGTAGTTAAA
AATTGTTAAAATTAACAATTTCATCTTGTATCCAATTATTTGTGTACAAA
TTTACTTCCCTTATTTCATTTTAAATTTTCATGCTCATTAAAAAGTGTAG
TTTAATAATTTATCT
Genomic location of TG246  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D136 marker 136
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)