SGN Marker T0141

SGN-M1365
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 8.07
Tomato EST read: TPSAP30TH
Arabidopsis best BAC match: AB005245.2
Arabidopsis position: 5.0050000
Arabidopsis identities: 0.866
Best GenBank protein hit: AAF67098.1
Evalue: 1.2e-64
Identities: 0.873
Description: delta-COP [Zea mays]
Comment: vesicle coatomer protein
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49433)
Chromosome
1
Position
83.84 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47367)
Chromosome
1
Position
119.29 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39608)
Chromosome
1
Position
129.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0141 was used as an overgo probe on plate 8 [well F3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAGCCGATAGAATCTCTGTACTTG
B sequence
TGTTGGTCACAAGGAGCAAGTACA
AB sequence
CAGCCGATAGAATCTCTGTACTTGCTCCTT
Marker sequence
TTCAATCTTCAATCTTCAGTAAGGTGGTATACGATCTATTGCCCAGGATC
TGATACAACAAAATCTACTAAGCAACAAAGATGGTTGTTCTAGCGGCTTC
CATAATTTCTAAATCTGGCAAAGCTCTTGTCTCGAGGCAATTTGTTGATA
TGTCTCGTATAAGAATTGAAGGATATCTTGCAGCTTTTCCCAAATTGGTT
GGTATAGGAAAGCAGCATACATATATTGAGACTGAAAATGTGCGATATGT
TTATCAGCCGATAGAATCTCTGTACTTGCTCCTTGTGACCAACAAACAGA
GCAACATTCTTGAAGATTTGGAGACACTGAGGCTGCTGTCTAAACTAGTG
CCTGAATATTCTTATTCACTAGATGAGGAAGGAATTGGCAGGACGGCTTT
TGAGCTTATTTTTGCATTTGATGAAGTGATCTCTCTTGGGCACAAGGAAA
AAGTTACAGTTACACAAGTCAAGCAGTTCTGTGAAATGGAGAGTCACGAA
GAGAGATTA
Genomic location of T0141  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1365 marker 1365
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)