SGN Marker T0181

SGN-M1374
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TOVAP21TH
Arabidopsis best BAC match: AC002130.2
Arabidopsis position: 1.1300000
Arabidopsis identities: 0.947
Best GenBank protein hit: AAG00249.1
Evalue: 4.9e-52
Identities: 0.586
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49496)
Chromosome
5
Position
10.76 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47430)
Chromosome
5
Position
80.97 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39787)
Chromosome
5
Position
69.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0181 was used as an overgo probe on plate 12 [well C1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTACACTGGTGGGATGGGAAATG
B sequence
ACACCATACATCCCACCATTTCCC
AB sequence
CTTACACTGGTGGGATGGGAAATGGTGGGA
Marker sequence
CTTTGCTGGAGGTTCTGCTTATCATTACAATTTTGGGAGCCGCCTTTCTG
GGGGGAGCCCGTACCGCCCGGTACATCTCTCCGCTCCACCTCCTTACACT
GGTGGGATGGGAAATGGTGGGATGTATGGTGTGCCACCACTAATGGACCG
ATATGGTGTAGCATTGCCAATGGCCCCTGCTGCCATGGCACCGAGGCCAG
GATTTTATCCTGATGATAATTCTCAAAAGAAAGATGGAACACGTGATAAT
GACTGGACATGTCCCAAGTGTGGCAATGTCAACTTTTCGTTTAGAACAGT
TTGTAACATGAGGAAGTGCAACACTCCAAAGCCTGGTTCTCAGGTTCCCA
AACCGGTGAAGAACACTAAACCAGATACGCCAGATGGAAGCTGGAAATGT
GAGAAGTGCAACAACATAAACTATCCTTTTCGGACCAAGTGTAACAGACA
GAATTGTGGTGCGGAGAAACCATCTGAAGCCAAGAAGTCTCCTTCACAAT
CAGCTGATGAGAATGATCAGTGAGTACTAAGGCTTGTTTAAGGTTGAGAA
GGTCCAGAGTT
Genomic location of T0181  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1374 marker 1374
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)