Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker T0196

SGN-M1378
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TOVAF14TH
Arabidopsis best BAC match: AL021811.1
Arabidopsis position: 4.1640000
Arabidopsis identities: 0.893
Best GenBank protein hit: CAB79936.1
Evalue: 3.2e-46
Identities: 0.885
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49499)
Chromosome
3
Position
57.25 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47433)
Chromosome
3
Position
76.85 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39808)
Chromosome
3
Position
96.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0196 was used as an overgo probe on plate 6 [well B11]

Plausible BAC Matches:   P054O21,   P313C15

 Overgo Sequences

A sequence
TGGGTGCACCATACATTGGAGGAA
B sequence
GGTGGGCCATGAATATTTCCTCCA
AB sequence
TGGGTGCACCATACATTGGAGGAAATATTC
Marker sequence
CTGGGTGCTTTTATGAGCTACGAAAAGCATGGTTTAGATGATCTGATGGT
CCATCACTTAGTGGAAAGATTCCCAATGGGTGCACCATACATTGGAGGAA
ATATTCATGGCCCACCGTTGGGAGATTTGAATGAGAAGATATCGTGGATG
GAGAAATTTGTGCGGAAGGGAACTGAAATTACTGCTCCTGTTCCAATGGC
TCCACCAGCTACTACCGGCCTTGGAGGCTTTGAAGTTCCATCATCTAAAG
GAGTTCTGCGATCTGATGCAAGCAAATTAAATGTAGGAGTTTTGCATCTG
GTCCCATCTTTGGAGGTTTTCCCACTTTTAGCAGATCC
Genomic location of T0196  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1378 marker 1378
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)